Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

MAINT: code tidy #197

Merged
merged 1 commit into from
Feb 27, 2025
Merged

MAINT: code tidy #197

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
7 changes: 1 addition & 6 deletions src/ensembl_tui/_mysql_core_attr.py
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -73,9 +73,7 @@ def load_db(db_name: pathlib.Path, table_names: set[str]) -> duckdb.DuckDBPyConn


location_attrs = {
# "coord_names": "coord_system",
"location": "seq_region",
# "meta": "meta",
}
gene_attrs = {
"stableid": "gene",
Expand Down Expand Up @@ -214,7 +212,7 @@ def start(self) -> int:
def stop(self) -> int:
return self.transcript_spans.max()

def to_record(self, columns: tuple[str]) -> tuple:
def to_record(self, columns: tuple[str, ...]) -> tuple:
cds_blob = (
eti_storage.array_to_blob(self.cds_spans)
if self.cds_spans is not None
Expand Down Expand Up @@ -418,6 +416,3 @@ def make_gene_attr(con: duckdb.DuckDBPyConnection) -> duckdb.DuckDBPyConnection:
"""
con.sql(sql)
return con


# the repeat and location related tables are left as is
2 changes: 1 addition & 1 deletion tests/test_cli.py
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -102,7 +102,7 @@ def test_check_one_cds_seq(installed):
"CAATTTTTGACCAAGGACTTGAAATTCCCATTGCCTCACAGAGTCCAAAAATCCACCAAG"
"ACTTTCTCCTACAAGAGACCTTCCACTTTCTACTGA"
)
assert str(cds.get_slice()) == expect
assert str(seq) == expect


@pytest.mark.slow
Expand Down