Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Integration of taxonomic classifier trainer wdl #459

Open
wants to merge 14 commits into
base: master
Choose a base branch
from
Open
Show file tree
Hide file tree
Changes from 8 commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
5 changes: 5 additions & 0 deletions .dockstore.yml
Original file line number Diff line number Diff line change
Expand Up @@ -357,5 +357,10 @@ workflows:
- name: qiime_import_bam
subclass: WDL
primaryDescriptorPath: /pipes/WDL/workflows/qiime_import_bam.wdl
testParameterFiles:
- empty.json
- name: train_16S_classifier
subclass: WDL
primaryDescriptorPath: /pipes/WDL/workflows/train_16S_classifier.wdl
testParameterFiles:
- empty.json
144 changes: 137 additions & 7 deletions pipes/WDL/tasks/tasks_16S_amplicon.wdl
Original file line number Diff line number Diff line change
Expand Up @@ -6,14 +6,24 @@ task qiime_import_from_bam {
}
input {
Array[File] reads_bam
Int memory_mb = 7000
Int memory_mb = 7000
Int cpu = 5
Int disk_size_gb = ceil(2*20) + 5
String docker = "quay.io/broadinstitute/qiime2"
}
parameter_meta {
reads_bam: {description: "Unaligned reads in BAM format, one sample per BAM file."}
reads_qza: {description: "All unaligned reads in a single QZA (QIIME) file"}
reads_bam: {
description: "Unaligned reads in BAM format, one sample per BAM file.",
category: "required"
}
reads_qza: {
description: "All unaligned reads in a single QZA (QIIME) file.",
category: "other"
}
samplename_master_sheet: {
description: "File contains all samples names.",
category: "other"
}
}

command <<<
Expand Down Expand Up @@ -69,17 +79,45 @@ task trim_reads {

input {
File reads_qza
#Boolean not_default = false
String forward_adapter = "CTGCTGCCTCCCGTAGGAGT"
String reverse_adapter = "AGAGTTTGATCCTGGCTCAG"
Int min_length = 1
Int min_length = 1
Boolean keep_untrimmed_reads = false
Int memory_mb = 2000
Int cpu = 4
Int disk_size_gb = ceil(2*size(reads_qza, "GiB")) + 5
String docker = "quay.io/broadinstitute/qiime2"
}

parameter_meta {
reads_qza: {
description: "All unaligned reads in a single QZA (QIIME) file.",
cateogry: "required"
}
forward_adapter: {
description: "Forward amplicon primer sequence.",
category: "advanced"
}
reverse_adapter: {
description: "Reverse amplicon primer sequence.",
cateogry: "advanced"
}
min_length: {
description: "Minimum length of the read, cutadapt will discard anything that is shorter than n bp AFTER trimming.Set to default.",
category: "other"
}
keep_untrimmed_reads: {
description: "Allows you to choose whether or not to discard untrimmed reads.",
category: "advanced"
}
trimmed_reads_qza: {
description: "Trimmed reads data file.",
category: "advanced"
}
trimmed_visualization: {
description: "A diagram that compares your demuxed reads before and after cutting (i.e. length of reads, how many reads were retained).",
category: "advanced"
}
}
command <<<
set -ex -o pipefail
qiime cutadapt trim-paired \
Expand Down Expand Up @@ -124,7 +162,20 @@ task join_paired_ends {
Int disk_size_gb = ceil(2*size(trimmed_reads_qza, "GiB")) + 50
String docker = "quay.io/broadinstitute/qiime2"
}

parameter_meta{
trimmed_reads_qza: {
description:"Trimmed reads data file.",
category: "required"
}
joined_end_reads_qza:{
description: "Merge paired read file.",
category: "other"
}
joined_end_visualization: {
description: "This summary is especially useful for assessing the length of linked reads and the quality scores at each sequence base position. ",
category: "other"
}
}
command <<<
set -ex -o pipefail
qiime vsearch join-pairs \
Expand Down Expand Up @@ -160,6 +211,32 @@ task deblur {
Int cpu = 1
Int disk_size_gb = ceil(2*size(joined_end_reads_qza, "GiB")) + 5
String docker = "quay.io/broadinstitute/qiime2"
}
parameter_meta {
joined_end_reads_qza: {
description: "Merge paired read file.",
category: "required"
}
trim_length_var: {
description: "Length that all seqeuences will be trimmed, and discard any sequences that are not at least this long.",
category: "advanced"
}
representative_seqs_qza: {
description: "Generate a list of the representative sequences. May be useful to the user if they want to blast these sequences or check for correct trimming.",
category: "other"
}
representative_table_qza: {
description: "Generate a table of the representaitve sequences.",
category: "other"
}
feature_table: {
description: "A table that represent the number of of features per sample, the number of samples a given feature is found in.",
category: "other"
}
visualize_stats:{
description: "Generate visualization of deblur stats.",
category: "other"
}
}
command <<<
set -ex -o pipefail
Expand Down Expand Up @@ -213,6 +290,37 @@ task train_classifier {
Int disk_size_gb = ceil(2*size(otu_ref, "GiB")) + 5
String docker = "quay.io/broadinstitute/qiime2"
}
parameter_meta{
otu_ref: {
description: "Operational taxonomic units (OTUs) sequences imported as FASTA file.",
category:"required"
}
taxanomy_ref: {
description: "Reference taxonomy file.",
category: "required"
}
forward_adapter: {
description: "The forward primer sequence for the amplicon target.",
category: "advanced"
}
reverse_adapter: {
description: "The reverse primer sequence for the amplicon target.",
category:"advanced"
}
min_length: {
description: "Minimum length of amplicon sequences.",
category: "advanced"
}
max_length: {
description: "Maximum length of amplicon sequences.",
category:"advanced"
}
trained_classifier: {
description: "Trained taxonomic classifier on target amplicon sequences.",
category: "other"
}
}

command <<<
set -ex -o pipefail
CONDA_ENV_NAME=$(conda info --envs -q | awk -F" " '/qiime.*/{ print $1 }')
Expand Down Expand Up @@ -266,6 +374,28 @@ task tax_analysis {
Int disk_size_gb = 375
String docker = "quay.io/broadinstitute/qiime2"
}
parameter_meta{
trained_classifier: {
description: "Trained taxonomic classifier on target amplicon sequences.",
category: "required"
}
representative_seqs_qza: {
description: "List of representative sequences.",
category:"required"
}
representative_table_qza: {
description: "Table of representative sequences.",
category:"other"
}
rep_seq_list: {
description: "Generate list of representative sequences.",
category:"other"
}
tax_classification_graph: {
description: "Create a bar graph of your taxonomic classification.",
category:"other"
}
}
command <<<
set -ex -o pipefail
qiime feature-classifier classify-sklearn \
Expand Down
26 changes: 26 additions & 0 deletions pipes/WDL/workflows/16S_train_classifier.wdl
Original file line number Diff line number Diff line change
@@ -0,0 +1,26 @@
version 1.0

import "../tasks/tasks_16S_amplicon.wdl" as qiime

workflow train_classifier_16S {
meta {
description: "User imports OTU database that will be trained on your primer sequences."
author: "Broad Viral Genomics"
email: "viral_ngs@broadinstitue.org"
allowNestedInputs: true
}
input {
File otu_ref
File taxanomy_ref
String forward_adapter
String reverse_adapter
}

call qiime.train_classifier {
input:
otu_ref = otu_ref,
taxanomy_ref = taxanomy_ref,
forward_adapter = forward_adapter,
reverse_adapter = reverse_adapter
}
}
26 changes: 26 additions & 0 deletions pipes/WDL/workflows/train_16S_classifier.wdl
Original file line number Diff line number Diff line change
@@ -0,0 +1,26 @@
version 1.0

import "../tasks/tasks_16S_amplicon.wdl" as qiime

workflow train_classifier_16S {
meta {
description: "User imports OTU database that will be trained on your primer sequences. All outputs can be visualized using https://view.qiime2.org/"
author: "Broad Viral Genomics"
email: "viral-ngs@broadinstitue.org"
allowNestedInputs: true
}
input {
File otu_ref
File taxanomy_ref
String forward_adapter
String reverse_adapter
}

call qiime.train_classifier {
input:
otu_ref = otu_ref,
taxanomy_ref = taxanomy_ref,
forward_adapter = forward_adapter,
reverse_adapter = reverse_adapter
}
}