Approach 3.ipynb

{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Cosine Similarity | Sentences of entire Document | Pubmed Model"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "  ⠀"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "  ⠀"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Loading the Documents"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Load Utility Libraries"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [],
   "source": [
    "from utility import Corpus, Document"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "search_list_txt\\A Comprehensive Review Article On Isoprostanes As Biological Markers.txt\n",
      "search_list_txt\\Anti Toxoplasma Gondii Activity Of 5 Oxo Hexahydroquinoline Derivatives   Synthesis, In Vitro And In Vivo Evaluations, And Molecular Docking Analysis.txt\n",
      "search_list_txt\\Assembling Structurally Customizable Synthetic Carriers.txt\n",
      "search_list_txt\\Asymptomatic Carrier State  Acute Respiratory Disease.txt\n",
      "search_list_txt\\Covid-19 Pathogenesis, Cytokine Storm And Cytokine Growth Factor Reviews.txt\n",
      "search_list_txt\\Deamidation In Moxetumomab Pasudotox Leading To Conformational Change And Immunotoxin Activity Loss.txt\n",
      "search_list_txt\\Development Of Muco Adhesive Orally Disintegrating Tablets Containing Tamarind Gum Coated Tea Powder.txt\n",
      "search_list_txt\\Hollow Fiber Based Liquid Phase Microextraction.txt\n",
      "search_list_txt\\Molecular Immune Pathogenesis And Diagnosis Of Covid 19.txt\n",
      "search_list_txt\\Molecular Pharmaceuticals.txt\n",
      "search_list_txt\\Multi Dimensional Visualization For The Morphology.txt\n",
      "search_list_txt\\Nanotechnology And Vaccine Development.txt\n",
      "search_list_txt\\Pegylation In Anti Cancer Therapy.txt\n",
      "search_list_txt\\Pharmaceutical Care In A Patient With Recurrent Infection After Liver Transplant.txt\n",
      "search_list_txt\\Pharmacological Options Beyond Proton Pump Inhibitors In Childrenwith Gastroesophageal Reflux Diseas.txt\n",
      "search_list_txt\\Phospolipids And Application.txt\n",
      "search_list_txt\\Phytochemical Screening And Evaluation Of Analgesic And Thrombolytic Activity Of The Crude Methanoli.txt\n",
      "search_list_txt\\Real Time Calorimetric Characterisation Of Clay Drug Complex Dispersions And Particles.txt\n",
      "search_list_txt\\Recent Advances And Perspectives Of Nucleic Acid.txt\n",
      "search_list_txt\\Redox Responsive Biocompatible Nanocarriers.txt\n",
      "search_list_txt\\Redox Sensitive  Peg Shielded Carboxymethyl Pei.txt\n",
      "search_list_txt\\Regorafenib Loaded Poly  Lactide Co Glycolide  Microspheres.txt\n",
      "search_list_txt\\The Effect Of Pramlintide, An Antidiabetic Amylin Analogue On Angiogenesis Related Markers In Vitro.txt\n"
     ]
    }
   ],
   "source": [
    "corp = Corpus('search_list_txt/')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "{'A Comprehensive Review Article On Isoprostanes As Biological Markers': ['biochemistry  pharmacology open accessissn 21670501review articleopen accessa comprehensive review article on isoprostanes as biological markers', 'various obsessive procedures include free radical intervened oxidative anxiety', ' the elaboration of solid and nonintrusive strategies for the assessment of oxidative worry in human body is a standout amongst the most critical stridestowards perceiving the assortment of oxidative disorders apparently created by reactive oxygen species ros', ' lipidperoxidation is a standout amongst the most wellknown components related with oxidative anxiety and the estimationof lipid peroxidation items has been utilized to assess oxidative worry in vivo conditions', ' the estimation of conjugateddienes and lipid hydro peroxide while the evaluation of optional final results incorporates thiobarbituric acid reactivesubstances vaporous alkanes and prostaglandin f2like items named f2isoprostanes f2ips', ' as of late f2ipshave been viewed as the most significant precise and solid marker of oxidative worry in vivo and their evaluation issuggested for surveying oxidant wounds in people', ' the motivation behind this paper is to give some data on organicchemistry of isoprostanes and their use as a marker of oxidative anxiety', '', 'lipid peroxidation prostaglandin f2 conjugatedproducts arachidonic acid metabolites', 'isoprostanes are formed from unsaturated hydrocarbons andare catalyzed by free radicals', ' isoprostanes show the formation ofdifferent stereoisomers', ' they normally show characteristics suchas biotic change mainly on the lungs and kidneys and useful fornormal functions of body', ' they are very important as makers foroxidative stress', ' few decades ago in 1967 isoprostanes were preparedin the laboratory but it came out clearly understandable that theywere set up in suitable in vivo and had significant biotech effects', 'the first isoprostane discovered in 1990 were f2isoprostanes', ' othertypes of isoprostanes include d2isoprostanes e2isoprostanes a2isoprostanes j2isoprostanes 1', '', 'undifferentiated from prostaglandins pgf2 to recognize upgraded ratesof lipid peroxidation', ' in mid1970 production of prostaglandins pglike mixes amid autooxidation of polyunsaturated and unsaturatedfats was found however isoprostanes were not found in people', ' until1990 f2isoprostanes were thought as constituents of 64 mixes ofdifferent isomeric structures', ' additional type of isoprostanes deliveredin vivo by order of obligated prostaglandins pgh2like isoprostane orintermediates 5', ' incorporate e2isoprostane and d2isoprostanescyclopentenonea2 and j2isoprostanes and the exceedinglyresponsive noncyclic ketoaldehydes isoketals', ' biological impactsof isoprostanes isops are settled by correspondence with receptor', 'the cyclopentenone  isoprostane isops for instance prostaglandinpga2 and prostaglandin pgj2 like mixes', ' the isoprostanes isopsway instantly adduct to lysine stays on proteins and initiate crosslinkages', ' its still dubious about the receptors required in isoprostanesisops activities', ' the vasoconstricting activity is interceded throughthromboxane tx receptor contender 6', 'there are some dissimilarity between prostaglandins pg andisoprostanes', ' prostaglandins are made from arachidonic acid whileisoprostanes are formed on lipid membranes from polyunsaturatedfatty acids and then they are set free by phospholipases', ' isoprostanesare also formed from docosahexaenoic and eicosapentaenoic acids', 'prostaglandins pg are a trans isomer while isoprostane is mainlycis', ' isoprostanes are similar to the common prostanoids in distinctmanners and the most accessible form is similar to postaglandin f2', 'prostaglandin pgd2 and prostaglandin pge2 are also found insimilar way but particularly they are different in their stereochemistry2', ' to differentiate between isoprostanes and prostaglandins weuse different abbreviations like pg for prostaglandin and isops forisoprostanes', ' the different positions of hydroxyl group in the ring helpto identify different isoprostanes structures 3', 'the recuperation of isoprostanes isops has vital importance formedication', ' it has now been shaped that estimation of f2isoprostanesis the most dependable way to deal with survey oxidative anxiety statusin vivo giving a critical instrument to look in to the part of biochemicalworry in the form of infection in human beings', ' in addition measuresof the isoprostane way have been found to apply solid organic activities', 'isops like 8isopgf2 and 8isopge2 have solid natural impacts indifferent frame works and they additionally fill in as arbiters of oxidantworry through their vasoconstrictive and energizing properties', ' 8isopgf2 have been notable to have vasoconstrictive impacts in differentorgans including aorta cerebrum cerebral arterioles kidney the lungaspiratory supply route retinal vessels and endothelium', 'isoprostanes isops are generated in situ in their esterifiedframe in tissues and by converted first to their free corrosive shapeand are conveyed in both the esterifies and free corrosive framein tissues 4', ' isoprostanes isops are groups of prostaglandinspg like compounds', ' they are produced by free radical catalyzedperoxidation of arachidonic acid and independent of cyclooxygenase', 'isoprostanes isops are created in situ in the phospholipid space of celllayers', ' the estimation of f2isoprostanes containing the fsort ringisoprostanes actuate irritation and atherogenesis through enactmentof map mitogen activated protein kinases', ' isoprostanes have vitalin vitro exercises that could be dependent to the pathophysiology ofatherosclerosis', ' it bolsters platelet enactment and actuates mutagenesis invascular smooth muscle cells affect proliferative reactions in fibroblastschanges endothelial cell science as exhibit by proliferative impacts andexpanded endothelin1 expression in oxlike aortic endothelial cells', ' ithas been sought that isoprostanes isops are oxidative anxiety creatorsas well as naturally dynamic', ' when they are discharged from cell layersby phosholipases flow in the plasma in free structures and in thismanner can initiate film receptors', ' 15f2tisop is a fractional againstat the tp thromboxane prostanoid receptor on platelets and henceit may control the proaggregatory impact of tp receptor incitement 8', 'this has inspected resulting impact of 8isopgf2 alpha 8isopgf2beta and 8isopgf3 alpha on human respiratory system', ' both8isopgf2 alpha and 8isopgf2 beta shaped focus subordinatewith drawls of smooth muscle from human extensive and little aviationroute', ' this research has impact of isoprostanes on human birth cordsupply route hua in vitro', ' birth code is connection between babyand mother placenta', ' quantitative constrictions were shaped by 8isopge2 8isopge1 8isopgf alpha 8isopgf2 alpha 8isopgf2beta', ' the consideration by the shrinking movement of 8isopgf2alpha and 8isopge2 was calculated in the confined rodent on theupper part of stomach detached rodent aorta and the segregated guineapig middle part of small intestine differentiate with the thromboxintx a2mimetic u46619 and the customary prostaglandin pge2', ' inthe confined rodent aorta 8isopge2 8isopgf2 alpha promptedvasoconstrictions in a fixation subordinate way 9', ' by correlation of thepec50 values the accompanying rank request of impact was settled u46619  8isopge2  8isopgf2 alpha  pge2 in the disconnectedrodent gastric fundus the rank request of impact settled by correlationof the pec50 was pge2  8isopge2  u 46619  8isopgf2 alpha', 'in the concealed guineapig ileum u 46619 and 8isopgf2 alphahad no impact while pge2 8isopge2 created focus subordinatewithdrawal', 'synthesis in animal tissuesunion of isoprostanes in individual tissues in vivo is realized bya progression of free radicalcatalyzed responses a large portion ofwhich dont include compounds and any unsaturated fats', ' keeping inmind the end goal to begin isoprostane arrangement prerequisite forresponsive oxygen species for example peroxyl radicals singlet oxygenetc under vigorous conditions in vivo in creatures and plants', ' the shapedexpanding sums under states of oxidative anxiety', ' the radical createdduring this process is non enzymatic all methylene assemblage betweentwo cis two fold bonds can conceivably include 11', ' the pentadienylradical an enantiomer mixture peroxy radical that tends to reorganizea shape equal sums alphaalpha and betabetabicyclic endoperoxyradicals who are arranged solely cis regarding the cyclopentane ring', 'later the bicyclic endoperoxy radical responds with a further oxygenparticle to deliver racemic hydroperoxyl bicyclic endoperoxy radicals', 'the item is an isoprostane isopg that is comparable of pgg2 which canbe reduced to the firm f2isop 12', ' comparative responses happen toshape isoprostanes with the hydroxyl assemble in positions 5 8 or 12', 'isoprostanes of the isopf arrangement are framed in restricted sumsjust in vitro however are significant metabolites in vivo through thedecline in isopgs by means of characteristic endogenous reductionsfor instance glutathione hematin lipoic corrosive unsaturated fator glutathione peroxidase', ' thromboxanelike mixes are created invivo at the point when the biosynthesis of isoprostanes proceeds bymeans of this endoperoxide course every one of the 64 conceivablebiochem pharmacol an open access journalissn21670501stereoisomers can be shaped', ' as the g and h  ring endoperoxidestructures are profoundly capable mixes with a halfexistence of just acouple of minutes they can isomerize quickly to form different itemsincluding analogs of pge2 and pgd2 ', ' they created intensely withf2isoprostanes', ' for instance glutathione gsh or αtocopherolare utilized arrangement of e2d2isops is favored', ' the isoprostanescontains cyclopentenone rings which is carbonyl gathering on theprostane ring and intimize to pga2 and pgj2', ' they are profoundlyresponsive electrophiles and act as nucleophile with addition of thiolsfor example found on cysteine stays in proteins and glutathioneconjugates', ' as the isoprostanes in individual tissues are delivered fromarachidonic corrosive transcendently in position 2 of phospholipids inlayers they should be discharged by the activity of phospholipase a2and related proteins before they can apply their principle physiologicalimpacts', ' in the free corrosive shape they can flow in the plasma andspeak with film receptors 14', ' anyhow it is conceivable that likewisehave some natural capacities while still identified with phospholipids', 'isoprostanes have all the earmarks of being disbanded by simpleenzymatic component', ' circling f2isoprostanes are depleted in thekidney and develop in the urine for example 2 3  dinor  15  f2and 2 3  dinor  5 6  dihydro  15  f2  isoprostanes which areadditionally discharged in the pee 15', 'in spite of the fact that the amalgamation of prostanoids by coxfirst requires that arachidonic corrosive release from the plasma layerby phospholipases', ' it is not acceptable for the creation of isoprostanesby free radicals and presently justifiable cause motivation to trustthat the last can follow up on free unsaturated fats and on those stillesterified to film phospholipids', ' isoprostanes have been recognizedinside phospholipids extricated from surgical examples of lungatherosclerotic vasculature lymphatics mind and preeclampsiadeciduas in the maternal part of placenta 16', ' in plasma of smokersthe degree of esterified isoprostanes increase benchmark for aconsiderable length of time after suspension of smoking despite thefact that different markers of smoking for example urinary nicotineand cotinine get to be distinctly imperceptible', ' in carbon tetrachlorideincited hepatotoxicity isoprostanes start to aggregate very quickly inphospholipids separated from the liver and to some degree in the lungsand kidney and presently in the course the last achieve a crest at 4 h77overlap and remain extraordinarily raised above standard at 2421crease and 48 10overlay h showing delayed oxidative anxiety aswell as progressing entrance of esterified isoprostanes', ' the nearness ofthe isoprostanes inside the layer depends upon film smoothness 17', 'isoprostanes give off an impression of being immediatelymetabolized and distributed', ' it was demonstrated in the rabbit thata dose of 8isopgf2α was quickly diffused with a halfexistence ofconsumption of approximately one min and after that was highlyintoxicated with a halfexistence of approximately 4 min', ' by usinghplc the further study shows that 8isopgf2α was debased toa few βoxidized metabolites coming full circle in arrangementof αtetranor15keto13 14dihydro8isopgf2α', ' it is speculatethat digestion system of this isoprostane be like a flowing pathwaylike that found out for prostaglandins', ' including the formation of15hydroxyprostaglandin dehydrogenase by oxidation of c15decrease of the c13 14 twofold bond by 15hydroxy prostaglandintook after by βoxidation to αtetranor15keto13 14dihydro8isopgf2α', ' the parent 8isopgf2α and product of metabolism begunto a mass in the urine inside 20 min 80 of the first radioactive dotwas present in the urine by 4 h 18', ' this investigation using a solitaryhuman come forward and a rhesus monkey the 75 of the infusedradioactivity was excreted in to the urine during the following 4', '5h and mix parent urine with the essential product of metabolismbeing 23dinor56dihydropgf2α', ' it is demonstrated that themetabolites likewise incorporate 2 3dinorpgf2α in people and 2 34 5tetranor5 6dihydropgf2α in rats', ' the synthetically responsiveisoeicosanoids for example the a2and isolevuglandins covalentlyadduct to proteins and are along these lines shielded from fast freedomby means of the kidney 19', 'isoprostanes as markers of oxidative stressoxidative anxiety indicates elevation of responsive oxygen speciesros and cell reinforcement guard', ' responsive oxygen species arecreated endogenously but they are produced by exogenous componentsfor example radiation tobacco smoke and medications', ' it is realizedthat oxidative anxiety is related with numerous intense and endlesssicknesses for example tumor and cardiovascular neurodegenerativeand lung illnesses', ' these days a few in vitro oxidative anxiety markersare accessible however they need affectability as well as specificity orrequire intrusive strategies 20', ' the quantity present in composershas endeavored to decide their amount in natural specimens in clinicaldisorders most likely connected with oxidative anxiety has kept onexpanding', ' till now it is notable that isop levels are expanded innatural examples on account of various cardiovascular aspiratory andneurological maladies the utilization of isoprostanes as markers ofoxidative anxiety has few points of interest over other oxidative anxietymarkers i', 'e', ' isoprostanes are particular results of peroxidation they areavailable in noticeable sums in tissues and organic liquids and they areunchanged by lipid substance in an eating regimen', ' since accumulationof pee is nonintrusive and on the grounds that isoprostanes areexceptionally steady in pee 21', ' there is an interesting speculation thatamid advancement in primitive cells isoprostane development cameabout because of the expanding vigorous conditions and these particleswere chosen as a method for flagging more particular uneven charactersin the redox condition of the cells', ' the isoprostane arrangementhas been held as a move down framework where enzymatic passagedevelops to generate eicosanoids as flagging particles', ' isoprostanes areaccepted to be beneficial markers of oxidative worry for animals andhuman being tissues which are characterized as an unsettling influencein the prooxidantantioxidant for adjustment', ' there is an unnecessarygeneration of lipid peroxidation items which might be included in theadvancement or worsening of malignant tumor cardiovascular andneurological sicknesses', ' they can be examined in every single organicliquid and tissues', ' in patients the level of oxidative worry is measure byisoprostanes and their metabolites in urine is a solid nonobtrusive wayto deal', ' in its measuring method there is no need of storage at 70 º cor to be worried about further art factual development of isoprostaneson capacity 22', 'the level of isoprostanes impact on sickness states and resultinghelpful intercession can be resolved', ' the level of isoprostane is measuredin conditions that are related with intemperate era of free radicalslike incorporating harming with paraquat and carbon tetrachloridesmoking liquor addiction and cirrhosis of the liver', ' numerous humaninfection states including cerebrum degeneration kidney illnessesischemiareperfusion harm atherosclerosis and diabetes are involvedin the pathophysiology 23', ' there is a great clinical proof that thecentralization of f2isops in urine is a free and aggregate indicatorof coronary disease showing classification of this metabolite inatherosclerotic plaques where like the thromboxane it might enactthe tp thromboxane receptor', ' in type 2 diabetes is a solid pointerof oxidative worry', ' lipid peroxidation is also indicator of numerousillness states related to mind in the isoprostane pathway the isopa2and isopj2 are typically thought to be the favored results and theyaffect neuronal apoptosis and compound neurodegeneration broughtabout by different putdown at fixations as low as 0', '1µm', ' the usefulgathering of the cyclopentenone isoprostanes can respond with thecysteine deposit of glutathione', ' the cysteine in cell proteins shows theharmful effect 24', ' isoprostanes and isofurans and neuroprostanes canbe determined from arachidonate', ' it is obtained from docosahexaenoiccorrosive', ' it has appeared in increment in fixation in unhealthydistricts of brains from patients who have suffered in alzheimersdisease and parkinsons infections', ' in the early phases of alzheimersand huntingtons illnesses there is an additional level of cerebrospinalliquid', ' the investigation is of symptomatic esteem and support forevaluation of case treatments', ' as the level f2 isoprostanes expandedunder states of oxidative stress they might be a specific marker of whitematter damage in vivo', ' the lifted focuses in mind tissues influenced byinjury are recognized by d2 and e2isoprostanes 25', 'it has turned out to be clear that in plasma and tissues theisoprostane levels elevated in plasma and tissues of fetal and earlyneonatal life in contrast with grownups and that they may havevital parts being developed and move to interval of life', ' the acceptedimperative wellspring of isoprostanes is placenta', ' the viability ofcancer prevention agents in vivo and to set up the estimation of cellreinforcement organization in clinical cases can be evaluated byurinary isoprostane', ' the vitamin e and more prominent αtocopherolis needed for cancer effectual hindrance agent in displaying themeasurements of 0', '04mgday and f2isop levels has been utilized toconcentrate the vitamin e specially in the form of αtocopherol', ' inpeople with shockingly levels of vitamin c supplements decreases thelevel of isoprostane 26', ' furthermore their esterified frame filmsisoprostanes are enduring markers of oxidative harm and they empowerthe site to be distinguished by endogenous lipid peroxidation', ' to besure it is conceivable that in this shape they have consequences for theease of films and might be in charge of some layer brokenness', ' for somereasons isoprostanes are extremely appropriate as markers of oxidativeanxiety', ' initially there quantity can be measured to picomolar levelswith logical strategies for example hplc gas chromatographymassspectrometry or radioimmunoassay', ' the previous two systems areremarkably ready to segregate between the diverse sorts of isoprostanes27', ' the less demanding instrument to perform experiments whichis generally financially accessible is radioimmunoassay', ' in the caseof diverse sorts of isoprostanes are these are not capable to recognizethe prostanoids and the isoprostanes', ' it is conceivable to utilizeisoprostanes to evaluate oxidative anxiety or harm in particular targetorgans of intrigue e', 'g', ' by means of biopsy for instance in carbontetrachlorideinitiated hepatoxicity isoprostanes were notably lifted inthe liver lung and kidney however not in the mind or heart 28', 'they supported segregated specimens of body liquids their nearnesswas initially identified in crisp and put away examples of plasma andurine', ' the especially energizing late advancement has exhibit andrecognized the lung diseases extremely not allowed to spread inthe body course to their estimation', ' their deliberate qualities dontdisplay diurnal varieties however do differ especially in clinical andtest situation portrayed by oxidative anxiety', ' the respiratory diseasesare related with isoprostanes', ' 8isopgf2α is created in considerablesums in something else ordinary people presented to tobaccosmoke allergen ozone or hyperoxia and amid oxygenated ischemiaparticularly goes up in patients with a broad variety of lung diseases', 'like asthma ceaseless obstructive pneumonic illness interstitiallung ailment cystic fibrosis intense lung harm including intenserespiratory misery disorder and extreme respiratory disappointmentin babies 29', ' also various cardiovascular conditions highlightstamped heights in isoprostane levels including renal syndromepain in chest and damaging tissues dangerous pain in heart areadisappointment coronary illness atherosclerosis and preeclampsia', ' thelevel of isoprostane increases in aspiratory high blood pressure andamid introduction to operators is related with high blood pressure forexample suppressor measurements of angiotensin ii fiery', ' the 8isopgf2α observed to be a helpful marker of oxidative stress and lipidperoxides in illness conditions various alzheimers infection sclerosisdiabetes mellitus systemic auto immune diseases and cirrhosisalcoholic liver disease and in test settings running from people in spaceflight to sled mutts amid continuance practice preparing 30', 'f2tisopm f2isops obesity and breast cancer riskno review has tentatively explored the etiologic part of f2isop and its metabolite in the improvement of bosom or differentdiseases', ' drs', ' milne and marrows worked to utilize breast canceras a malady display', ' the relationship of urinary f2isop and 15f2tisopm by using the instrument like gas chromatography negativeion chemical ionization mass spectroscopy gcnicims testwith bosom growth hazard in a settled casecontrol contemplate', ' inthe course of recent years various reviews have reliably watched thatoverweight or corpulent ladies had a fundamentally lifted level off2isops demonstrating ladies with an abnormal state of body massindex bmi have an exorbitant creation of ros which cause oxidativeanxiety', ' in this way among overweightlarge ladies elevated amountsof 15f2tisopm and additionally f2isops might be identified withan expanded danger of breast cancer', ' alternately among ladies withtypical body mass index bmi minimum level of ros is importantto activate p53 enactment specifically intervene cell death and inciteagedness', ' also f2isops found to build the glucoseinitiated blend oftgfβ1 a basic tumor silencer at introductory level 31', ' it is alongthese lines not amazing that few defensive elements for bosom growthhazard for example physical action equality typical pregnancyand preeclampsia were connected to essentially hoisted levels oflipid peroxidation', ' in view of these discoveries it is conceivable thatthe part of ros among ladies with a typical bmi body mass indexmight be unique in relation to overweightlarge ladies', ' we in this wayconjectured the relationship between levels of f2isops and 15f2tisopm and bosom malignancy may shift by bmi status and furtherassessed this speculation in the swhs', ' urinary levels of 15f2tisopmand f2isops did not fundamentally vary by bosom tumor status', 'levels of f2isops and 15f2tisopm were identified with a decreaseddanger of bosom malignancy among ladies with a bmi less than 25', 'the ladies having bmi less than 23 high level of f2isops', ' it is relatedwith a diminished danger of bosom tumor in a dosage reaction wayp for pattern 0', '006 with an overall risk stroke of 0', '46 95ci 0', '260', '80 32', ' among ladies with a low bmi the diminishment in hazardshowed up in both preand postmenopausal ladies', ' conversely15f2tisopm and f2isops were related with an expanded danger ofbosom tumor among ladies with a bmi25', ' the affiliations got to bedistinctly more grounded with expanding levels of bmi', ' 15f2tisopmwas connected to a 2to 4overlay lifted hazard among ladies with abmi more than 27', '5 the ors raised to 10', '20 95 ci 2', '3544', '29 forthe center tertile and 10', '27 2', '4143', '80 for the most elevated tertileversus the most reduced tertile p for pattern 0', '003 p for cooperationwith bmi bmi29 versus bmi29 0', '0004 among ladies with abmi29', ' the comparing ors 95 cis additionally lifted to 13', '621', '38134', '08 and 23', '47 2', '46223', '69 p for communication 0', '001among those with a bmi of at least 30', ' fundamentally the same asresults were acquired in the affectability investigation barring bosomtumor quiet analyzed inside 3 years from pee accumulation', ' the rosis responsible for bosom malignancy is distinctive by bmi position and15f2tisopm is a more delicate and particular biomarker of oxidativeworries than f2isops among overweightcorpulent subjects', 'sops as biomarkers of lipid peroxidation in neurodegenerative disorderoxidative anxiety is generated by an irregularity of free radicalsgeneration and cell reinforcement protections for the oxidation andprompts to lipid peroxidation layer protein and dna harm and isthought to be essential to cause diseases of an assortment of neurologicalissue particularly neurodegenerative sicknesses and tumor maturing', 'the most vital wellspring of ros intervened specifically harmsneuronal layers and yields various auxiliary items in charge of broadcell harm', ' a particular repair procedure of lipid peroxidation doesnot survive as it achieve for proteins and dna', ' the level of lipidperoxidation could have physiological criticalness for cell flagging andfilm renovating 34', ' the mind is the most helpless to oxidative harmin light of various elements like high oxygen utilization the low levelsof cancer prevention agent chemicals the lifted levels of iron and thecapacity to oxidize distinctive substrates', ' regardless of the way thatfree radicals can assault numerous different basic natural atoms forexample dna and cell proteins', ' peroxidation of film lipids influencesneuronal homeostasis bringing about increased layer firmness lessenedaction of film bound compounds e', 'g', ' na pump devastation of filmreceptors and changing porous', 'the way of ros is unsteady and exceedingly receptive', ' there aremany challenges in direct measurement of ro level', ' it is difficult toexplain the significance of oxidative harm in neurological infections', 'due to this reason the measurement of f2isops by mass spectrometryinstrument is commonly used', ' it measures the best quality level listof lipid peroxidation in vivo', ' isops found moderately in body liquidssince they are regularly found in pee blood and cerebrospinal fluidare additionally present in the breathed out', ' the development of isopsin vivo can be dependably checked in each organic liquid withoutusing any instrument', ' the estimations of particular signs of lipidperoxidation which have a tendency to be delicate particularly 36', 'the estimation of f2isops in vivo go up and show up as the most solidways to deal with survey oxidative anxiety status giving an essentialapparatus to investigate the part of oxidative worry in the infectivehuman', ' in the oxidative tissue harm the level of f2isop is altogetherexpanding', ' the fast improvement of explanatory strategies for isopsestimation cleared up the part of the free radicals in human physiologyand disorder in philology system cause different diseases', ' estimation off4nps steady result of ros harm and docoshexaenoic acid dhaadditionally gives significant information in investigating the part ofoxidative worry in neurodegenerative maladies', ' the results of the isoppassage have solid natural activities and take physiological arbiters ofthe illness 37', ' research on cerebrum determined isops has givenpersuading proof on the helpfulness of these markers in comprehensionpart of oxidative harm in mind infections', ' isops are dynamic results ofros which moderates the oxidation of arachidonic acid aa whichcontained in phospholipids of cell layers', ' the lipoproteins have apotential pertinence to harm the sheath of myelin and neurons maladiesin human', ' the ros harm the pathogenesis of neurodegenerative tissue', 'the raised development of f2isops can be seen in mind tissues andbody liquids in various neurodegenerative ailments', ' the estimation offree f2isops in plasma or urine can be used to evaluate the endogenicdevelopment of isops however not to uncover the organ in whichthey are framed', ' deciding the levels of isops in the interesting liquidcompartment cerebro spinal fluid csf gives an awesome chanceto uncover the event of oxidative anxiety and lipid peroxidation in themind', 'multiple sclerosismultiple sclerosis ms is heterogeneous illness with a fewpathophysiological segments like aggravation demyelination redoxaxonal harm and repair forms', ' ms is a main source of neurologicalinabilities in youthful grownups and influences up to 2', '4 ofpopulation in usa and canada and up to 1', '9 in some europeannations', ' ms also affects on genes focusing on few bases', ' there aredifferent clinical courses on this issue', ' the great degree of backslidingtransmitting course relapsing remitting multiple sclerosis rrmsin which backslide happens every now and then followed up byentire or fractional recuperation', ' this phase of illness is describedwith multifocal aggravation oedema and cytokines activities', ' aboutportion of relapsing remitting multiple sclerosis rrms patientsfollowing 120240 months of illness enduring collect irreparablenervous system disorder', ' this kind of ms is auxiliary dynamic is kindof secondary progressive multiple sclerosis spms that is controlledby nervous system degeneration procedures and movement of scientificside effects', ' the 20 of ms patients have dynamic side effects fromthe beginning of onset essential dynamic primary progressive multiplesclerosis ppms sort 39', ' the movement of rrms to dynamicstage is dependable on injury in brain', ' right now characterizationsof indicators of ms are associated with the physiological abnormalityforms', ' it is divided into seven classesindicator is displayed a single of numerous continuous infectiveprocedures', ' it was found that the pee isops level was more than 6overlay hoisted in patients with spms than in charge', ' to examine theconceivable relationship betweens f2isops and the illness incendiaryaction', ' the cerebro spinal fluid csf levels of 15isops in patientswith rrms were not corresponded with the scientific indications of theailment', ' the perceptions recommend large amounts of f2isops mayspeak to a file of degenerative marvels which continue likewise in theabsence of a progressing provocative action', ' it is also indicated the levelof csf is dependable indicator of oxidative worry', ' the level 15 isopis 3 times higher in patients with ms as compare to reference subjectswith other disorder of nervous system', ' in steroid treated patient thelevel of 15isop level is low', ' the level of disability is related with thelevel of 15 isop', ' in the spinal line of mice amid early dynamic phases oftest immune system encephalomyelitis eae the hoisted levels of f2isops and f4nps were watched', ' in white matter and myelinframingoligo dendrocytes', ' the moderately low level of the docosahexaenoicacid dha levels also influenced the ms', ' as lipid peroxidationbiomarker of f2isops may be desirable over f4neuroprostanes f4nps in the demyelinating ailment 41', ' there is the connection foundbetweens levels of f2isops in csf of ms patients', ' the csf groupingsof f2isops are higher in ms patients', ' where the f2isops levels inpatients experiencing ms were moderate between kin and in additioncontrol7', ' remyelination and repair neural cell grip particle ncamcntf ciliaryneurotrophic consider and cpkbb creatinephosphatase bb', 'alzheimers disease ad is one of the serious sources of mentalillness', ' it is identified by the accumulation of the amyloid β aβpeptide and microtubuleassociated protein particle in the brain', ' theserious part in the ad pathological process activates an abnormaltau phosphorylation', ' the aβ interaction with transition elements inthe form of ions which play role in lipid peroxidation and cellularoxidative stress', ' the amyloid βpeptide aβ grows cellular oxyradicalsdeposition in neurons and glial cells of brain to harm the brain', ' inthis disease many of metabolic oxidative stress may lead to manyof the metabolic and loss the structure and function of brain', ' in tauphosphorylation the intervention of oxidant toxicity by aβ has beenalso involved', ' furthermore in the oxidative pressures has been observedin ad and the mitochondrial loss the efficiency of electron transportactivity', ' there is variety of markers of oxidative stress which showsrelationship with aβ accumulation and neurofibrillary degeneration inad patients 43', ' during the oxidative stress protein degrees of variousantioxidant enzymes were changed in ad brain regions', ' the f2isopsand f4nps levels also increased in the postmortem ventricular fluidof ad patients', ' the level of csf f2isops could not be making useas an early marker of mental illness', ' there is no correlation betweenthe level of csf f2isops and duration of disease', ' it is proved that inad patients brain the presence of esterified f4nps abnormally highlevels in occipital and temporal lobes of brain', ' in ad patients thevitro oxidation of dha docosahexaenoic acid produces 3', '4timeshigher levels of f4nps as compared with f2isops where the csf levelsof these two classes of compounds showed a very close correlation44', ' according to yao and praticò researcher the concentration of15isops and ipf2alphavi level increase in the frontal and temporallobes of ad brains as compared to the same regions of control brains', 'the levels 6keto pgf1alpha an index of prostaglandin productionand ventricular csf 15isop levels did not differ in ad and controlsubjects', 'in ms isops is the hopeful indicator of lipid peroxidation', ' inailments of a mind boggling process of pathologic in an individualthe level of f2isops is higher in plasma and urinary levels werehigher in ad as compare to control', ' the increase level of isop in1', ' the variation of the safe framework interleukins il1 il2il4 il6 il10 il12 il23 interferon tumor rot considertumor necrosis factor tnf changing developmentcalculate transforming growth factor beta tgfβ cytokineschemokine receptor factor 3chemokine ligand 10 cxcr3cxcl10marker enacted thymus cells endothelialselectin leukocyteselectin icam1intracellular adhesionmoleculei vcam1vascular cell adhesion moleculecluster cluster differentiation cd31 surface articulationof lymphocyte associated antigenl lfa1 and very lateantigen4 vla4 grip atoms cluster of differentiation40cluster of differentiation40cluster of differentiation 40ligand cd40cd40l cd80 cd86 and warm stun proteins2', ' axonalneuronal harm tau protein 24shydroxycholesterolnacetylaspartic corrosive', '3', ' bloodcerebrumobstructiondisturbancenetworkmetalloproteinases mmps platelet initiating componentpaf and thrombomodulin', '4', ' demyelination mbp and mbplike material proteolyticcatalysts', '5', ' oxidative anxiety and excitotoxicity nitric oxide subordinatesf2isops and uric corrosive', '6', ' gliosis glial fibrillary corrosive protein gfap s100proteinplasma and urine in ad patients increase oxidative stress', ' the level off2isops levels in females control group were higher than in males andit is related to greater degree in oxidative stress incorporated with thedrop of estrogens in the postmenopausal period 41', 'huntingtons diseasethe genetic disease due to anomalous elaboration of an unstablebases cytosineadenineguanine repeat region at the 5end of a geneon chromosome 4', ' this genetic abnormality results defect on genescausing the death of specific populations of striatal neurons', ' themitochondrial losing the activity of electron transport as result theoverproduction of ros leading to nitrosative stress in hd patients', 'such stress contributes to disorder the nervous system and damagedna proteins and lipids 38', ' the mitochondrial respiration isinhibited by highly reactive product of nitric oxide and superoxide freeradicals peroxynitrite', ' this also reduce antioxidant defense system ofcells due to this reason the immune reactivity of 3nt is increased inpostmortem hd patients of brain tissue', ' in striatum and cerebral cortexthe levels of protein carbonyls increase', ' the level of 4hydroxynonenaland malondialdehyde lipid peroxidation products are increased eighttimes in hd human plasma and also in postmortem brain tissue', ' thelevels of f2isop in hd patients are higher and cause oxidative stressthan control group', ' in hd plasma patients the glutathione levels aresignificantly reduced', ' 24', 'creutzfeldtjakob diseasecreutzfeldtjakob disease cjd is a standout in human andtransmissible spongiform encephalopathies tses or prion maladiesa miscellaneous gathering of tempting scattered and hereditary issueportrayed mental illness', ' the sign of nervous system disease trademarkneuropathological sign of the illness is the granulose proof of theneurotic type of a cell protein like in adaβ or hdhuntington', ' thegathering of the neurotic prior protein is considered a focal occasionand activate a few pathogenic components in the end coming full circlein the common degenerative diseases of brain 28', 'around 2', '5crease higher than in patients with antiinflammatory issue', 'it is found that there is no relationship between 15isops and pge2', 'in patients neither the level of 15isop levels nor polymorphism atcodon 129 of the prion protein quality showing that lipid peroxidationand prostaglandin blend are insignificant wonders of this illness', ' incontrols prostaglandin e2 pge2 fixations are 6', '5overlay higher andcontrarily related with patient life', ' the level of 15 isop is not relatedwith the illness of patient', ' it has been suggested that t oxidative worry tpathogenesis of this specific infection is more serious 15 25', 'it is demonstrated in different reviews that the elevation of pge2 inbrain memory part is related with cox2 which is lifted with movementof disease and is restricted to glial cells', ' in sporadic cjd patients theshorter survival was related with more elevated amounts of pge2', ' incsf patients pge2 might be a case of serious disease as opposed tomovement in light of the fact that pge2 levels are not depend on csfinvestigating throughout illness', ' pge2 can be related with neuronaldemise in light of the fact that in malignant cells infected proteinpeptides addition of pge2 highness and cyclo oxygenasel cox1prohibitory ensures opposition of infected protein poisonous', ' anyhowpge2 adds to neuron cells demise in cjd is a result of neuronal celldeath', ' it is only a record of the illness condition stays to be set upfigure 1 and 2 41', '', 'isoprotane is the product of lipid peroxidation in cell membrane', 'it is reliable biomarker of oxidative stress', ' isoprostane disrupt thethe biological elements of cell like prion protein is obscure in anycase because of its cooper restricting capacity it may assume an essentialpart in the oxidative homeostasis of the mind and could go about asa cancer prevention agent', ' these cancer prevention agent propertiesmight be identified with its superoxide dismutasesod like action', 'this has been demonstrated that elevated amounts of prion protein incell', ' this makes the cell impervious for oxidative anxiety', ' the degree ofa few oxidative anxiety markers and gatherings of protein carbonyl areresults of lipid peroxidation', ' they were expanded in cerebrum tissuesof prion protein', ' it had been found the scarpie contaminated mindof mice increase levels of nitrotyrosine and heme oxygenase1', ' moreprion proteins decreased sodlike action in the creature in which therecommended that level of lipid peroxidation items is expanded inbrains of scrapie contaminated mice 31', 'in different cases the increased degrees of f2isop in cerebrospinalfluid csf of creutzfeldtjakob patients have been seen', ' the variationas compare to control has been observed to be unchanged in csf frompatients experiencing creutzfeldtjakob disease cjd is result oflipid peroxidation', ' the nondemanded controls were more helpless tooxidation in csf lipids from patients experiencing cjd', ' it is observedthat cancer prevention agents and the measure of pufas levels decreaseof in the cjd patients where oxidative anxiety is raise', ' the pathogenesisof this disease is related to oxidative system', ' it has been observed that inpatients with sporadic and hereditary cjd csf levels of 15 isop werefigure 1 isoprostane is group of postaglandin like compound', ' these areproducts of free radicals with arachidonic acid including arachidonic esters inphosopholipids', ' the product form on cell membrane is called lipid peroxidation', 'its reliable biomarker to express the oxidative stress', ' isoprostanes disrupts thebiological cell membrane', ' isoprostane product is rapidly cleaved metabolizedand excrete from cell', ' normal function of isoprostane is not only to acts asvasoconstrictor but it also indicate to promote mutagenesis', ' the cell adhesionmoncytes promote the induction of endothelial cell necrosis', '20', ' zhang r zhang q niu j lu k xie b et al', ' 2014 screening of micrornasassociated with alzheimers disease using oxidative stress cell model anddifferent strains of senescence accelerated mice', ' j neurol sci 338 5764', '21', ' jacob kd noren hooten n trzeciak ar evans mk 2013 markers of oxidantstress that are clinically relevant in aging and agerelated disease', ' mechageing 134 139157', 'figure 2 different ring structures of isoprostanes', 'biological cell membrane', ' isoprostane promotes the mutagenesistypically isoap2 and isopj2 favored the isoprostanes pathways', ' thepostaglandin like iso f2ips f2 isoprostanes is the most solid andprecise biomarker of oxidative stress', '', '1', ' enciu am gherghiceanu m popescu bo 2013 triggers and effectors ofoxidative stress at bloodbrain barrier level relevance for brain ageing andneurodegeneration', ' oxid med cell longev 2013 29751222', ' farooqui aa horrocks la farooqui t 2007 interactions between neuralmembrane glycerophospholipid and sphingolipid mediators a recipe for neuralcell survival or suicide', ' j neurosci res 85 18341850', '23', ' gonsette re 2008 neurodegeneration in multiple sclerosis the role ofoxidative stress and excitotoxicity', ' j neurol sci 274 4853', '24', ' halliwell b lee cy 2010 using isoprostanes as biomarkers of oxidativestress some rarely considered issues', ' antioxid redox signal 13 145156', '25', ' barrera g 2012 oxidative stress and lipid peroxidation products in cancerprogression and therapy', ' isrn oncol 137289', '26', ' dotan y lichtenberg d pinchuk i 2004 lipid peroxidation cannot be used asa universal criterion of oxidative stress', ' progress in lipid research 43 200227', '2', ' niki e 2008 lipid peroxidation products as oxidative stress biomarkers', 'biofactors 34171180', '27', ' milne gl yin h hardy kd davies ss roberts lj 2011 isoprostanegeneration and function', ' chem rev 111 59735996', '3', ' santos r almodovar cr bulteau al gomes cm 2013 neurodegenerationneurogenesis and oxidative stress', ' oxid med cell longev 2013 730581', '28', ' roberts lj ii morrow jd 2002 products of the isoprostane pathway uniquebioactive compounds and markers of lipid peroxidation', ' cellular and molecularlife sciences 59 808820', '4', ' cappellano g carecchio m fleetwood t magistrelli l cantello r et al', '2013 immunity and inflammation in neurodegenerative diseases', ' am jneurodegener dis 2 89107', '5', ' almer g teismann p stevic z halaschekwiener j deecke l et al', ' 2002increased levels of the proinflammatory prostaglandin pge2 in csf from alspatients', ' neurology 58 12771279', '6', ' farooqui t farooqui aa 2011 lipidmediated oxidative stress andinflammation in the pathogenesis of parkinsons disease', ' parkinsons disease2011 247467', '7', ' guest j grant r mori ta croft kd 2014 changes in oxidative damageinflammation and nadh with age in cerebrospinal fluid', ' plos one 9 e85335', '8', ' roberts ii lj milne gl 2009 isoprostanes', ' journal of lipid research 50219223', '9', 'mattsson n haghighi s andersen o yao y rosengren l et al', ' 2007elevated cerebrospinal fluid f2isoprostane levels indicating oxidative stressin healthy siblings of multiple sclerosis patients', ' neurosci lett 414 233236', '10', ' minghetti l greco a cardone f puopolo m ladogana a et al', ' 2000increased brain synthesis of prostaglandin e2 and f2isoprostane in humanand experimental transmissible spongiform encephalopathies', ' j neuropatholexp neurol 59 866871', '11', ' montine tj quinn jf milatovic d silbert lc dang t et al', ' 2002 peripheralf2isoprostanes and f4neuroprostanes are not increased in alzheimersdisease', ' ann neurol 52 175179', '29', ' hardy kd cox be milne gl yin h roberts lj ii 2011 nonenzymatic freeradicalcatalyzed generation of 15deoxyδ1214 j2like compounds deoxyj2isoprostanes in vivo', ' j lipid res 52 113124', '30', ' murphy rc fahy e 2010 isoprostane nomenclature more suggestionsprostaglandins leukotrienes and essential fatty acids 82 6970', '31', ' harris sg padilla j koumas l ray d phipps rp 2002 prostaglandins asmodulators of immunity', ' trends immunol 23 144150', '32', ' reich ee markesbery wr roberts lj ii swift ll morrow jd et al', ' 2001brain regional quantification of fring and dering isoprostanes andneuroprostanes in alzheimers disease', ' am j pathology 158 293297', '33', ' streck el czapski ga gonc c da silva a 2013 neurodegenerationmitochondrial dysfunction and oxidative stress', ' oxid med cell longev 2013826046', '34', ' chen y morrow jd roberts lj ii 1999 formation of reactive cyclopentenonecompounds in vivo as products of the isoprostane pathway', ' j biol chem 2741086310868', '35', ' chen y zackert we roberts lj ii morrow jd 1999 evidence for theformation of a novel cyclopentenone isoprostane 15a2tisoprostane 8isoprostaglandin a2 in vivo', ' biochimica et biophysica acta molecular and cellbiology of lipids 1436 550556', '36', ' obrien rd 2009 fats and oils analysis in fats and oils formulating andprocessing for applications', ' crc press boca raton fla usa', ' pp 197260', '12', ' yao y zhukareva v sung s clark cm rokach j et al', ' 2003 enhancedbrain levels of 812isoipf2𝛼vi differentiate ad from frontotemporal dementia', 'neurol 61 475478', '37', ' de felice c signorini c durand t oger c guy a et al', ' 2011 f2dihomoisoprostanes as potential early biomarkers of lipid oxidative damage in rettsyndrome', ' j lipid res 52 2297', '13', ' praticò d my lee v trojanowski jq rokach j fitzgerald ga 1998increased f2isoprostanes in alzheimers disease evidence for enhanced lipidperoxidation in vivo', ' faseb j 12 17771783', '38', ' barden ae corcoran tb mas e 2012 is there a role for isofurans andneuroprostanes in preeclampsia and normal pregnancy antioxid redoxsignal 16 165169', '14', ' browne se beal mf 2006 oxidative damage in huntingtons diseasepathogenesis', ' antioxid redox signal 8 20612073', '39', ' brooks jd milne gl yin h sanchez sc porter na et al', ' 2008 formation ofhighly reactive cyclopentenone isoprostane compounds a 3j3isoprostanesin vivo from eicosapentaenoic acid', ' j biol chem 283 1204312055', '15', ' kralovicova s fontaine sn alderton a brown d 2009 the effects of prionprotein expression on metal metabolism', ' mol cellular neurosci 41 135147', '16', ' wong bs pan t liu t sy ms 2000 prion disease a loss of antioxidantfunction biochem biophys res commun 275 249252', '40', ' comporti m signorini c arezzini b vecchio d monaco b et al', ' 2008 f2isoprostanes are not just markers of oxidative stress', ' free radic biol med 44247256', '17', ' minghetti l cardone f greco a pocchiari m 2002 increased csf levelsof prostaglandin e2 in variant creutzfeldtjakob disease', ' neurol 58 127129', '41', ' zajamilatovic s gupta rc aschner m milatovic d 2009 protection of dfpinduced oxidative damage and neurodegeneration by antioxidants and nmdareceptor antagonist', ' toxicol app pharmacol 240 124131', '18', ' arlt s kontush a zerr i buhmann c jacobi c et al', ' 2002 increasedlipid peroxidation in cerebrospinal fluid and plasma from patients withcreutzfeldtjakob disease', ' neurobiol dis 10 150156', '42', ' milatovic d montine tj aschner m 2011 measurement of isoprostanes asmarkers of oxidative stress', ' methods mol biol 758 195204', '19', ' mitsumoto h santella rm liu x bogdanov m zipprich j et al', ' 2008 oxidativestress biomarkers in sporadic als', ' amyotroph lateral scler 9 177183', '', ''], 'Anti Toxoplasma Gondii Activity Of 5 Oxo Hexahydroquinoline Derivatives   Synthesis, In Vitro And In Vivo Evaluations, And Molecular Docking Analysis': ['research in pharmaceutical sciences august 2020 154 367380received 29102019peer reviewed 17022020revised 28042020accepted 20082020published 28082020', 'background and purpose the aim of this study was to evaluate the in vitro and in vivo antitoxoplasma gondii t', ' gondii effect of 5oxohexahydroquinoline compounds', ' moreover molecular docking study of thecompounds into the active site of enoylacyl carrier protein reductase enr as a necessary enzyme for thevitality of apicoplast was carried out', 'experimental approach a number of 5oxohexahydoquinoline derivatives z1z4 were synthesized', ' thet', ' gondii tachyzoites of rh strain were treated by different concentrations 164 μgml of the compounds', 'the viability of the encountered parasites with compounds was assessed using flow cytometry and propidiumiodide pi staining', ' due to the high mortality effect of z3 and z4 in vitro their chemotherapy effect wasassessed by inoculation of tachyzoites to four balbc mice groups n  5 followed by the gavage of variousconcentrations of the compounds to the mice', ' molecular docking was done to study the binding affinity of thesynthesized 5oxohexahydroquinolines into enr enzyme active site byusing autodock vina software', 'docking was performed by a lamarckian genetic algorithm with 100 runs', 'findings  results flow cytometry assay results indicated compounds z3 and z4 had relevant mortality effecton parasite tachyzoites', ' besides in vivo experiments were also performed and a partial increase of micelongevity between control and experiment groups was recorded', ' molecular docking of z3 and z4 in the bindingsite of enr enzyme indicated that the compounds were well accommodated within the binding site', ' thereforeit could be suggested that these compounds may exert their antit', ' gondii activity through the inhibition of theenr enzyme', 'conclusion and implications compounds z3 and z4 are good leads in order to develop better antit', ' gondiiagents as they demonstrated both in vitro and in vivo inhibitory effects on tachyzoites viability and infection', 'further studies on altering the route of administration along with additional pharmacokinetics evaluations areneeded to improve the antit', ' gondii impacts of 5oxohexahydroquinoline compounds', '', 'flow cytometry molecular docking 5oxohexahydroquinoline propidium iodide toxoplasma', 'toxoplasma gondii t', ' gondii is anintracellular protozoan parasite which causestoxoplasmosis a common zoonotic infection inhumans and animals 1', ' the estimationindicates that disease prevalence rate in humansis onethird of the world population people whohave been chronically infected', ' the parasiteengenders severe medical complicationsin the fetus and also immunocompromisedpeople 2 3', 'moreover despite of the relatively low rate oftoxoplasmosis outbreak in immunocompetentones some studies report severe toxoplasmosisin healthy patients 4 5', ' t', ' gondii istransmitted by felids whereas their coccidianlifestyle through sexual reproduction leads topouring oocysts in outside of their bodies 68', 'rodents and other intermediate hosts mayingest oocysts bringing about the initialexpansion of growing tachyzoites and thusdisseminating to all over the body which leadsto acute infection of the parasite', ' in response totachyzoites attack throughout the body theimmune reaction of the intermediate hostsbody occurs and then parasite converts into therecumbent and slowgrowing form of theparasite called the bradyzoite 9', ' finally theingestion of raw meats or water involvingoocysts causes infection in humans', 'the conventional treatment oftoxoplasmosis in humans comprises of acombination of drugs of sulfadiazine blocksdihydropteroate synthetase and pyrimethamineor trimethoprime which inhibits dihydrofolatereductase 10', ' t', ' gondii first disseminates astachyzoites then resides in tissue cystscausing a prolonged latent infection', ' inimmunocompromised patients bradyzoites canturn into tachyzoites that may cause pneumoniaand encephalitis', ' despite all advancements indrug discovery encysted bradyzoites have notbeen yet destroyed by suitable drugs 11', 'quinolines are a group of heterocyclicaromatic organic compounds with a multitudeof medicinal properties 1215', ' quinoline ringand one of its derivatives 2methyl3carbethoxyquinoline were eligible to inhibitthe t', ' gondii growth 5257 loss of a uniquenonphotosynthetic organelle of t', ' gondiitachyzoites called apicoplast 16', ' thesynthesis of heme isoprenoid precursors andfattyacid synthesis fas ii pathway is donewithin this particular organelle1718', ' theenoylacyl carrier protein reductase enr isamong the specific enzymes fas ii pathwaythe final and integral stage in the fatty acidchain elongation 17', ' attempts have farrevealed the vulnerability of a host of t', ' gondiito inhibition of fatty acids pathway and enrsubsequently by triclosan 1920', ' as tocompare with previous studies quinolinederived drugs such as 4aminoquinolinesand 8amino quinolines were more efficaciousin treating malaria disease than revealinginhibition effect on t', ' gondii growth', ' on theother hand benzylquine and bisquinoline wereamong the promising compounds againstt', ' gondii with ec50 values less than 1 μm incomparison with other candidates that havebeen used in the study which killed lesst', ' gondii 21', ' another research showed thatendochinlike quinolone can reduce braint', ' gondii tissue cyst numbers in mice due toinhibition of t', ' gondii cytochrome bc1 function22', ' a review study reveals that the quinolinering has antit', ' gondii activity throughmechanisms of heme polymerization anddegradation in the food vacuole membranetransport interruption in the parasite 19 candisrupt apicoplast dna and finally the wholeapicoplast in the parasite 1623', 'regarding quinoline derivatives biologicaleffectswesynthesized5oxohexahydroquinoline analogs bearing differentaromatic substitutions at c4 while havingdifferent pyridyl alkyl carboxylates at c3fig', ' 1 and evaluated them for their in vitro andin vivo inhibitory effects on the viability andinfectivity of toxoplasma tachyzoites', 'alternatively5oxohexahydroquinolinederivatives were obtained by the reactionamong oxobutanoate 2a 2b or 2ccorresponding aromatic aldehyde 2 mmol and13cyclohexanedione 2 mmol in the presenceof ammonium acetate 10 mmol in ethanol7 ml for 8 h while protected from lightfig', ' 2 15', ' the reaction was monitored bythinlayer chromatography tlc', ' ethanol wasremoved under reduced pressure and theresidue was dissolved in chloroform', ' then thereaction mixture was purified by tlc withchloroformethanol as the mobile phase', 'finally the product was recrystallized from theproper solvent to yield pure compoundsfig', ' 2', ' all the molecular structures of finalproducts were classified and confirmed byir 1h nmr mass spectrometry ms andelemental analysis', ' chemical structures andphysical properties of the synthesizedcompounds are shown in table 1chemicalsanalytical degree chemicals and solventswere used in this experiment', ' pyridine2ylmethanol pyridine3ylmethanol pyridine3ylpropanolaldehydesand13cyclohexanedione were provided from merckdarmstadt germany', ' propidium iodide piwas obtained from sigmaaldrich usa', 'apparatusescarbon13 nuclear magnetic resonance13 c nmr and proton 1h nmr spectra weredetected with a brucker 300 spectrometer', 'infrared ir spectra were acquired on a perkinelmer spectrometer kbr disk perkinelmerwaltham ma', ' chemical shifts were reportedas ppm and tetramethylsilane was used as aninternal standard', ' mass spectra ms wererecorded with an agilent spectrometer agilenttechnologies 9575c inert msd usa', ' acostech elemental analysis instrumentcostech esc 4010 italy was achieved as theelemental assessment and was within 0', '4  ofthe calculated value', ' a hot stage apparatuselectrothermal essex uk was used to attainmelting points', 'biological activity proceduresanimalsinbred balbc mice aging 68 weeks andweighing 2527 g were purchased from pasteurinstitute tehran i', 'r', ' iran', ' the whole proceduresof trials and sacrifices were identical for allanimals', ' in the course of the experimentsstarting from november 2017 and ending up tofebruary 2018 animals were maintained at22 c with about 4050 relative humidity andalso standard food and water ad libitum wereavailable', ' the in vivo study was conductedbased on the laboratory animals guidelines inliterary and research disciplines 24', 'synthesisof5oxohexahydroquinolinederivatives z1z4oxobutanoates 2a 2b and 2c weresynthesized by reacting pyridin3ylmethanol1a pyridin2ylmethanol 1b or pyridin3ylpropanol 1c with 2 2 6trimethyl4h1 3dioxin4one in high yields as shown in fig', ' 2', 'logp logarithm of partition coefficient between noctanol and water hba number of hydrogen bond acceptorshbd number of hydrogen bond donors tpsa topological polar surface area nrb number of rotatable bonds mwmolecular weight', 'parasitesthe virulent t', ' gondii rh strain wasprovided from tehran university of medicalsciences tehran i', 'r', ' iran', ' t', ' gondiitachyzoites were taken by a serialintraperitoneal passage in balbc inbred miceand then they were collected 72 h after theinoculation of 106 parasites in the mice byrepeated flushing in the peritoneal cavity usingphosphatebuffered saline pbs at a ph of 7', '2', 'next tachyzoites were harvested andcentrifuged for 10 min at 200 g at 25 c toeliminate the peritoneal cells and cellulardebris', ' the supernatant was then gathered andcentrifuged for 10 min at 1200 rpm 800 g 25', 'at 4 c', ' then the tachyzoites were gathered ineppendorf tubes staining with 50 μgmlconcentration of pi for 30 min at 4 c', ' finallythe parasites were preserved on ice and in darkcondition until analysis', ' positive controls wereobtained by incubation of the parasites in thevicinity of 0', '2 saponin', ' the cell suspensionwas transferred into polystyrene flowcytometry tubes bd falcon usa', ' dataachievement and evaluation were performedwith a facs calibur flow cytometer bectondickinson san jose usa and cell quest prosoftware 25', 'chemotherapy effect of the compoundsa number of 2  105 tachyzoites weresubcutaneously inoculated into 5 groups 5mices in each group including threeconcentrations 16 32 64 μgml ofcompounds z3 z4', 'the other groups werenegative and positive control sufadiazine 4μgml', ' based on ic50 determination study ofcompounds z3 z4 these compounds wereextracellular viability assay flow cytometrycompounds z1z4 were dissolved indimethyl sulfoxide dmso to attain a 10 mmstock solution', ' the tachyzoites 2  105ml ofpbs were treated with dmso 0', '1 vv asthe control and various concentrations 164μgml of 5oxohexahydroquinolines for 2 h370selected for chemotherapy in mice', ' toxicityassessment of compounds z3 and z4 wasperformed in the 6th group of mice thecompounds were orally gavaged into mice thathave not been inoculated by the intact parasites', 'for the negative control the mice only havebeen inoculated with parasites', ' sulfadiazine15 mgkg as an active substance was orallyadministered against t', ' gondii in the positivecontrol group', 'resulting from docking was ranked due to thefree energy of the interactions of ligandreceptors', ' validation of molecular docking wasdone by extracting the structure of thecocrystallized ligand and redocking it into thereceptor selfdocking', ' the root mean squaredeviation rmsd was used to evaluateoptimize and validate the docking calculations', 'we investigated the binding affinities of thesynthesized 5oxohexahydroquinolines intoenr enzyme active site', ' the docking processused a lamarckian genetic algorithm with 100runs for each ligand leaving other parametersat their default measures 28', ' conformationswere clustered and ranked by the energy', ' theconformation with the bestscored pose and thelowest binding energy was selected', ' thedocking results were depicted usingchemoffice software', 'molecular docking analysisthe 3d structures of the synthesizedcompounds were sketched using chemofficesoftware 26 then the achieved structureswere optimized in their conformation by theenergy minimization process in which theresults were saved in pdb formats', ' after energyoptimization and ligand preparation thegastigers partial charges and the number oftorques angles of molecules were calculated', 'the ligands were also saved in pdbqt formats', 'in this study we applied autodock vinasoftware to inquire about the affinity andbinding modes of the synthesized derivatives tothe binding pocket of pgp', ' xray crystalstructure of enoylacyl carrier proteinreductase enoyl acp reductase in complexwith triclosan and nad pdb id 2o2s wasgot from rcsb protein data bankhttpwww', 'rcsb', 'org', ' to prepare the enzymefor docking we removed the innate ligand andwater molecules added hydrogen atomsmerged nonpolar hydrogens and addedgasteiger charges', ' all rotatable bonds ofligands defined by default of the program wereallowed to rotate during the automated dockingprocess and then prepared protein and ligandstructures were saved in the pdbqt formatsuitable for calculating energy grid maps', ' autodock tools were used to prepare the moleculesand parameters before submitting it for dockinganalysis with auto dock 27', ' the griddimensions were 30  30  30 å along with agrid space value of 1 å', ' the grid was centeredat 3', '177 67', '997 and 67', '535 å x y and zwhich involved the active site of triclosan', ' it isnotable to say that macromolecule sequenceswere considered rigid and inflexible', ' besidesthe exhaustiveness factor was considered 8and then each of the conformational structuresstatistical analysisdata analysis was done by facs calibur flowcell quest pro software and spss softwareversion 22 armonk ny usa using the oneway anova test as appropriate', ' intergroupcomparisons were undertaken using tukeysposthoc test after log transformation for nonparametrically distributed variables', ' 𝑃  0', '05was contemplated statistically significant', '', '', '5oxohexahydroquinoline derivatives havebeen synthesized and evaluated for their antit', 'gondii activities', ' in conclusion 5oxohexahydroquinoline seems to be an attractivescaffold in this field and provides the context offurther research for lead optimization and drugdiscovery', ' compounds z3 baering 2pyridylmethyl carboxylate and 345trimethoxyphenylat c3 and c4 and z4 containing 23pyridylpropyl carboxylate and 4methoxyphenyl moietyat c3 and c4 are good leads in order to developbetter antit', ' gondii agents as they demonstratedboth in vitro and in vivo inhibitory effects ontachyzoites viability and infection', 'acknowledgmentsthis project was retrieved from pharm', ' d', 'thesis of mohammadsaeid zahedi which wasfinancially supported grant no', ' 95010513026 by the vicechancellor of research andtechnology of shiraz university of medical', '', '1', ' dunay ir gajurel k dhakal r liesenfeld omontoya jg', ' treatment of toxoplasmosis historicalperspective animal models and current clinical practice', 'clin microbiol rev', ' 2018314e0005717133', 'doi 10', '1128cmr', '0005717', '2', ' hoffmann s batz mb morris jg', ' annual cost ofillness and qualityadjusted life year losses in the unitedstates due to 14 foodborne pathogens', ' j food prot', '201275712921302', 'doi 10', '43150362028x', 'jfp11417', '3', ' weiss lm dubey jp', ' toxoplasmosis a history ofclinical observations', ' ', ' int j parasitol', ' 2009398895901', 'doi 10', '1016j', 'ijpara', '2009', '02', '004', '4', ' carme b demar m ajzenberg d dardé ml', ' severeacquired toxoplasmosis caused by wild cycle oftoxoplasma gondii french guiana', ' emerg infect dis', '2009154656658', 'doi 10', '3201eid1504', '081306', '5', ' khan a ajzenberg d mercier a demar m simons darde ml et al', ' geographic separation of domesticand wild strains of toxoplasma gondii in french guianacorrelates with a monomorphic version ofchromosome1a', 'plosneglecttropdis', '201489e3182112', 'doi 10', '1371journal', 'pntd', '0003182', '6', ' freppel w ferguson dj shapiro k dubey jp puechph dumètre a', ' structure composition and roles of thetoxoplasma gondii oocyst and sporocyst walls', ' cellsurf', ' 20195100016100026', 'doi 10', '1016j', 'tcsw', '2018', '100016', '7', ' dubey jp', ' the history and life cycle of toxoplasmagondii', ' in weiss lm kim k editors', ' the modelapicomplexanperspectives and methods', ' 3th ed', ' newyork academic press 2020', ' pp', ' 119', 'doi 10', '1016c20110071570', '8', ' ramakrishnan c maier s walker ra rehrauer hjoekel de winiger rr et al', ' an experimentalgenetically attenuated live vaccine to preventtransmission of toxoplasma gondii by cats', ' sci rep', '20199114741487', 'doi 10', '1038s41598018376718', '9', ' saraf p shwab ek dubey jp su c', ' on thedetermination of toxoplasma gondii virulence in mice', 'exp parasitol', ' 20171742530', 'doi 10', '1016j', 'exppara', '2017', '01', '009', '10', ' konstantinovic n guegan h stäjner t belaz srobertgangneux f', ' treatment of toxoplasmosiscurrent options and future perspectives', ' foodwaterborne parasitol', ' 201915e00036115', 'doi 10', '1016j', 'fawpar', '2019', 'e00036', '11', ' murata y sugi t weiss lm kato k', ' identificationof compounds that suppress toxoplasmagondiitachyzoitesandbradyzoites', 'plosone', '2017126e0178203114', 'doi 10', '1371journal', 'pone', '017820312', ' kumari l mazumder a pandey d yar ms kumarr mazumder r et al', ' synthesis and biological potentialsof quinoline analogues a review of literature', ' minirev org chem', ' 20191665388', 'doi 10', '21741570193x1666619021310514613', ' ranjbar s edraki n firuzi o khoshneviszadeh mmiri r', ' 5oxohexahydroquinoline an attractivescaffold with diverse biological activities', ' mol', ' divers', '201923471508', 'doi 10', '1007s110300189886414', ' ranjbar s khonkarn r moreno a baubichoncortay h miri r khoshneviszadeh m et al', ' 5oxohexahydroquinoline derivatives as modulators of pgpmrp1 and bcrp transporters to overcome multidrugresistance in cancer cells', ' toxicol appl pharm', '201936213649', 'doi 10', '1016j', 'taap', '2018', '10', '02515', ' ranjbar s firuzi o edraki n shahraki o saso lkhoshneviszadeh m et al', ' tetrahydroquinolinonederivatives as potent pglycoprotein inhibitors designsynthesis biological evaluation and molecular dockinganalysis', ' medchemcomm', ' 20178191933', 'doi 10', '1039c7md00178a16', ' kadri d crater ak lee h solomon vrananvoranich s', ' the potential of quinoline derivativesfreeenergyfunction', 'jcomputchem', '1998191416391662', 'doi 10', '1002sici1096', '29', ' hegewald j gross u bohne w', ' identification ofdihydroorotate dehydrogenase as a relevant drug targetfor 1hydroxyquinolones in toxoplasma gondii', ' molbiochem parasitol', ' 20131901615', 'doi 10', '1016j', 'molbiopara', '2013', '05', '008', '30', ' barbosa bf gomes ao ferro eav napolitano drmineo jr silva nm', ' enrofloxacin is able to controltoxoplasma gondii infection in both in vitro and in vivoexperimental models', ' vet parasitol', ' 2012187124452', 'doi 10', '1016j', 'vetpar', '2011', '12', '039', '31', ' da silva rj gomes ao franco ps pereira asmilian ic ribeiro m et al', ' enrofloxacin and toltrazurilare able to reduce toxoplasma gondii growth in humanbewo trophoblastic cells and villous explants fromhuman third trimester pregnancy', ' front cell infectmicrobiol', ' 20177340360', 'doi 10', '3389fcimb', '2017', '00340', '32', ' khan aa slifer tr araujo fg remington js', 'activity of gatifloxacin alone or in combination withpyrimethamine or gamma interferon against toxoplasmagondii', ' antimicrob agents chemother', ' 20014514851', 'doi 10', '1128aac', '45', '1', '4851', '2001', '33', ' mcphillie m zhou y el bissati k dubey j lorenzih capper m et al', ' new paradigms for understandingand step changes in treating active and chronic persistentapicomplexan infections', ' s sci rep', ' 201662917929202', 'doi 10', '1038srep29179', '34', ' burrows jn burlot e campo b cherbuin sjeanneret s leroy d et al', ' antimalarial drug discoverythe path towards eradication', ' parasitol', ' 20141411128139', 'doi 10', '1017s0031182013000826', '35', ' parsons jb frank mw subramanian c saenkhamp rock co', ' metabolic basis for the differentialsusceptibility of grampositive pathogens to fatty acidsynthesis inhibitors', ' proc natl acad sci u s a', '2011108371537815383', 'doi 10', '1073pnas', '1109208108', '36', ' yao j rock co', ' how bacterial pathogens eat hostlipids implications for the development of fatty acidsynthesistherapeutics', 'chem', '20152901059405946', 'doi 10', '1074jbc', 'r114', '636241', '37', ' vaughan am oneill mt tarun as camargo nphuong tm aly as et al', ' type ii fatty acid synthesis isessential only for malaria parasite late liver stagedevelopment', ' cell microbiol', ' 2009113506520', 'doi 10', '1111j', '14625822', '2008', '01270', 'x', '38', ' goodman c mcfadden g', ' fatty acid biosynthesis asa drug target in apicomplexan parasites', ' current drugtargets', ' 200781530', '39', ' surolia n surolia a', ' triclosan offers protectionagainst blood stages of malaria by inhibiting enoylacpreductase of plasmodium falciparum', ' nat med', '200172167173', 'doi 10', '103884612', 'for the treatment of toxoplasma gondii infection', ' expparasitol', ' 2014145135144', 'doi 10', '1016j', 'exppara', '2014', '08', '008', '17', ' brinster s lamberet g staels b trieucuot p grussa poyart c', ' type ii fatty acid synthesis is not a suitableantibiotic target for grampositive pathogens', ' nature', '200945872348386', 'doi 10', '1038nature07772', '18', ' salasnavarrete c hernándezchávez g flores nmartínez lm martinez a bolívar f et al', ' increasingpinosylvin production in escherichia coli by reducing theexpression level of the gene fabiencoded enoylacylcarrier protein reductase', ' electron j biotechnol', '2018331116', 'doi 10', '1016j', 'ejbt', '2018', '03', '001', '19', ' anquetin g greiner j vierling p', ' quinolonebaseddrugs against toxoplasma gondii and plasmodium spp', 'curr drug targets infect disord', ' 200553227245', 'doi 10', '21741568005054880172', '20', ' mcleod r muench sp rafferty jb kyle de muiej kirisits mj et al', ' triclosan inhibits the growth ofplasmodium falciparum and toxoplasma gondii byinhibition of apicomplexan fab i', ' int j parasitol', '2001312109113', 'doi 10', '1016s0020751901001114', '21', ' radke jb burrows jn goldberg de sibley ld', 'evaluation of current and emerging antimalarialmedicines for inhibition of toxoplasma gondii growth invitro', ' int j parasitol', ' 2001312109113', 'doi 10', '1016s0020751901001114', '22', ' doggett js nilsen a forquer i wegmann kwjonesbrando l yolken rh et al', ' endochinlikequinolones are highly efficacious against acute and latentexperimental toxoplasmosis', ' proc natl acad sci u s a', '2012109391593615941', 'doi 10', '1073pnas', '1208069109', '23', ' smith at livingston mr mai a filetici p queenersf sullivan wj', ' quinoline derivative mc1626 aputative gcn5 histone acetyltransferase hatinhibitor exhibits hatindependent activity againsttoxoplasma gondii', ' antimicrob agents chemother', '200751311091111', 'doi 10', '1128aac', '0125606', '24', ' akins ck panicker se cunningham cl', ' laboratoryanimals in research and teaching ethics care andmethods am psychol assoc', ' 2005', '25', ' asgari q keshavarz h rezaeian m motazedianmh shojaee s mohebali m et al', ' direct effect of twonaphthalenesulfonylindole compounds on toxoplasmagondii tachyzoite', ' j parasitol res', ' 2013201318', 'doi 10', '11552013716976', '26', ' buntrock re', ' chemoffice ultra 7', '0', ' j chem infmodel comput sci', ' 200242615051506', 'doi 10', '1021ci025575p', '27', ' trott o olson aj', ' autodock vina improving thespeed and accuracy of docking with a new scoringfunction efficient optimization and multithreading', ' jcomput chem', ' 2010312455461', 'doi 10', '1002jcc', '21334', '28', ' morris gm goodsell ds halliday rs huey r hartwe belew rk et al', ' automated docking using alamarckian genetic algorithm and an empirical binding', ''], 'Assembling Structurally Customizable Synthetic Carriers': ['asian journal of pharmaceutical sciences 15 2020 356364assembling structurally customizable syntheticcarriers of sirna through thermodynamicallyselfregulated processguang bai tong xue xiaotao dong uday kumar chinta jia feng tuo jin fei wuschool of pharmacy shanghai jiao tong university shanghai 200240 china', 'this study demonstrates that our previously reported polywraplex a synthetic sirna carrier consisting of a unimolecular polyplex core of customizable size and a selfassembled triblock copolymer envelop may be constructed using dendrimers as the crosslinking junctions', ' replacing the branched low molecular weight pei with polyamidoamine pamam dendrimer in the zeta potential regulated polymerization resulted in the similar network structured cationic polymer with electron microscopically visible crosslinking', 'networked cationic polymer thermodynamically selfregulated processes sirna delivery unimolecular polyplex zeta potential regulated polymerization', 'while the ability of nucleic acids to express silence edit andregulate genes enable them to be powerful therapeutic agentsin potential the lack of safe and efficient carrier systems todeliver them to sites of action retarded practical applications12', ' synthetic carriers of nucleic acids are regarded to besafe biologically and have attracted extensive research effortshowever the advances are still far from satisfactory 35', 'the synthetic carriers most reported to date polyplexeslipoplexes micelplexes synthetic lipidoids and hydrophobicpolymer particles were assembled rather randomly witharbitrary amounts of functional components immobilized610', ' mesoporous silica nanoparticles with a variety ofmodified inner surface and dendritic cationic polymerrepresent alternative synthetic carrier systems of semidefined structure 1112', ' although the nanoarchitecturesof dna or rna may be constructed precisely through thepreprogrammed assembly they are less functioning becausethe building blocks are chemically homogenous to what theydeliver 1314', ' there has yet to be a synthetic carrier ofnucleic acids assembled as precise in structure and functionin cell targeting as viral vectors the natureexisting nanomachinery capable to deliver genetic materials to host cells', 'despite the stillstanding unmet need reports in this fieldseem to have decreased dramatically in the literature in recentyears 15', ' even though some newly emerged topic may haveattracted public attention lack of new strategies to overcomethe encountered difficulties may have compromised peoplesenthusiasm', 'to address the situation we reported a preciselycustomizable and broadly applicable nanovehicle forresearchers to easily functionalize according to their specificneeds recently 16', ' this system known as polywraplexconsists of a phresponsive polyplex core of customizablesize and a selfassembled monolayer membrane of rationallydesigned triblock copolymer membrane to immobilizefunctional components', ' the polyplexforming cationicpolymer possesses a unisized networked structure andimidazole45diimine involved backbone which was formedby zeta potential regulated polymerization of spermine andbranched low molecular weight pei through imidazole45dicarbaldehyde', ' since the increased zeta potential of thegrowing polymer inhibited more of the cationic reactantsto approach the polymerization was selfterminated ata size', ' the beauty of the art is that this size customizedcationic polymer packed sirna intramolecularly to form aunimolecular polyplex when sirna was gradually added intoits solution 16', ' the imidazole ring involved in the polymerbackbone possesses a pka of 5', '9 for which endosomal phmay induce protonation of the ring and disruption of thefairly stable conjugated π bond of the imine linkages 17', ' theselfassembled monolayer membrane was formed by triblockcopolymer which was consisted of a negative multicarboxylsaccharide head that lead the whole triblock copolymer tothe polyplex core a polycaprolactone pcl middle block thatformed hydrophobic layer to isolate the internal and externalwater environment and to prevent sirna from degrading byrnase in vivo and a polyethylene glycol peg block whichmade the whole nanoparticle keep a neutralized conditionand prohibit sirna nonspecific absorption in vivo', ' this triblock copolymer membrane selfassembled around the phresponsive polyplex core may not only prevent prephagocyticsirna leaking and charge induced nonspecific bindingbut also offer a convenient way to immobilize functionalcomponents in the optimized surface population 18', 'to further clarify the network structure of thepolymer we replaced the branched low molecular peiwith polyamidoamine pamam dendrimer in the zetapotential regulated polymerization in the present studyin order to observe the crosslinking junctions electronmicroscopically', ' the obtained electron microscopic imagesfurther indicated the expected networked structureand a series of physical chemical characterizationsincluding the surface assembly and biological assays357confirmed the same nature and functions of polyplex andpolywraplex', '2', 'materials and methods2', '1', 'materialsimidazole45dicarbaldehyde and peg45pcl20maltotriosecoo was synthesized as our previous study 1718', ' polyamidoamine pamam g6 was purchasedfrom cyd company weihai china', ' spermine pei25k and dimethylformamide dmf were obtainedfrom sigmaaldrich ma usa', ' antivegfa sensestrand 5 ggaguacccugaugagaucdtdt3  antisensestrand5 gaucucaucaggguacuccdtdt3 cy3and cy5labeled sirna were all purchased fromgenepharma shanghai china', ' the vegfa primerforward 5 aggagggcagaatcatcacg3 and reverse5 gatccgcataatctgcatggt3  and the gapdh primerforward 5 ccaaggtcatccatgacaac3 and reverse 5 tccacagtcttctgagtggc3  were synthesized by andobtained from sangon biotech shanghai china', ' u87mgcell line was acquired from guo shengrong laboratory atshanghai jiao tong university shanghai china', ' 5weekoldmale babc nude mice were acquired from experimentalanimal center of shanghai jiao tong university shanghaichina', ' the usage of animal was performed according to theguideline of institutional animal care and use committeeiacuc of shanghai jiao tong university', '2', '2', 'synthesis and characterization of the networkedcationic polymerspermine 40 mg 0', '197 mmol in water 2 ml imidazole45dicarbaldehyde 30 mg 0', '247 mmol in dmfwater 1 ml1 mlwere mixed and stirred at room temperature for 12 h thecolor of the solution changed from colorless to dark redfollowing which pamam 143 mg 2', '47 μmol in water 2 mlwas added to the mixture dropwise for 2 h with continuousstirring at room temperature', ' the endpoint of the reactionwas measured using dynamic laser scattering dls to detectthe size of the networked cationic polymer', ' at last thesolution was subjected to dialysis by a cutoff size 10 kdacellulose membrane to remove the organic solution dmf andfinally lyophilized to get the final polymer 16', '2', '3', 'formation and characterization of polyplex andpolywraplexpolyplex was formulated by dropping sirna solution intonetworked cationic polymer in a series mass ratio ofsirnacationic polymer 11 12 13 15 17 110 115and 120 incubated for 30 min at room temperature', ' thepolyetherimide 25 k pei 25 k polyplex as the positive controlgroup was processed through mixing sirna solution andpei 25 k solution in mass ratio wsirna wpei25k  12 in equalvolume', ' the condensing ability of polyplex was confirmedby agarose gel electrophoresis', ' polywraplex was preparedby dropping triblock surface copolymer into the selected358asian journal of pharmaceutical sciences 15 2020 356364polyplex wsirna wcationic polymer  17 solution incubatedfor 30 min at room temperature', ' both particle size and zetapotential of the polyplexes and polywraplexes were measuredusing dls zetasizer nano malvern', ' microscopic morphologyof polyplexes and polywraplexes were determined usingtransmission electron microscope tem fei', '2', '4', 'serum stability of polyplex and polywraplexthe polyplex was formulated as presented insection 2', '3 wcationic polymer wsirna  71 and the polywraplexwtriblock copolymer wcationic polymer  121followedbyincubated with 50 fetal bovine serum fbs at 37 c for48 h', ' samples were taken at each time and detected usingelectrophoresis', '2', '5', 'cell culturehuman primary glioblastoma cell line u87mg was cultured indulbeccos modified eagle medium dmem gibco containing10 fbs penicillin 100 unitsml and streptomycin100 μgml in a cell incubator at 37 c with 5 co2 ', '2', '6', 'intracellular uptake of polyplex and polywraplexusing flow cytometryu87mg cells were seeded onto 48well microplates 10  104cellswell and incubated at 37 c for 24 h', ' subsequently cy3labeled sirna polyplex and polywraplex contained sirnawas 500 ngwell were added respectively', ' after incubatingfor 4 h the cells were harvested and detected using flowcytometry bd', ' the data was assessed using flowjo software', '2', '7', 'intracellular distribution of the polyplex andpolywraplex using confocal laser scanning microscopy clsmu87mg cells were seeded in 12well plate with 14 mm coverglass and incubated at 37 c for 24 h 1  104 cellswell', ' themedium was replaced then the cy3labeled sirna containedsirna was 2000 ng polyplex and polywraplex solution wereadded to the wells respectively', ' after incubation for 4 hthe cells were washed three times with pbs stained withlysotracker green 75 nm and dapi 2 μgml and imagedusing clsm', '2', '8', 'cytotoxicity of the network cationic polymeru87mg cells were seeded onto 96well microplates andincubated for 24 h at 37 c', ' the cytotoxicity of the networkcationic polymer against u87mg cells was evaluated usingcell counting kit8 cck8 kit dojindo', ' following the cck8 kitprotocol the cells were incubated with the network cationicpolymer in pbs solution of concentration from 20 to 300 μgmlfor 4 h in which the same concentrations of pei 25k pbssolution were as positive control then the cck8 agent wasadded into the 96well microplates', ' after 2 h the absorbanceat 450 nm was measured using microplate reader moleculardevices', ' the result was normalized to untreated cells', '2', '9', 'determination of vegfa gene silence of polyplex andpolywraplex in u87mg cells using qpcru87 mg cells were seeded onto 24 well microplates 10  105cells well and incubated at 37 c for 24 h polyplex containedsirna was 1 μg well were added onto the wells andincubated in fbs free dmem culture for 4 h subsequentlythe culture was substituted with 10 fbs', ' after 24 h cellswere harvested total mrna was extracted using trizolthermofisher and reverse transcribed into cdna usingprimescript rt reagent kit takara', ' the realtime qpcr wasoperated using eppendorf mastercycler', ' to assess the genesilencing ability of polywraplex against the interference offbs polywraplex contained sirna was 1 μgwell were addedonto the wells and incubated in 10 fbs dmem culture for4 h and exchanged with fresh dmem medium containing 10fbs', ' after 24 h cells were harvested and pcr reaction wasprocessed as previously described', '2', '10', 'in vivo distribution of polywraplexto assess the distribution of systemic delivery of cy5sirnapolypwraplex required utilization of tumor models performedby inoculating u87mg cells to male balbc nude mice underthe right armpits skin 2  106 cells', ' when the tumor wasallowed to mature volume 150200 mm3  mice were dividedinto naked cy5labeled sirna cy5labeled sirna polyplexand cy5labeled sirna polywraplex groups randomly', ' eachof the groups was intravenously injected with dosage format the dose of 0', '5 mgkg respectively', ' after 24 h the tissuesof mice were harvested and fluorescence image using ivisinstrument perkinelmer was performed', '2', '11', 'tumor suppression test in vivoto evaluate the ability of tumor suppression in vivo inoculatedu87mg cells were injected into the mice as previouslydescribed', ' when the tumor volume reached 150200 mm3 mice were randomly divided into four groups 6 mice eachgroup saline naked antivegfa sirna antivegfa sirnapolyplex and antivegfa sirna polywraplex', ' the miceof each group were injected the dosage form at the doseof 0', '5 mgkg through the tail vein every 7 d the lengthl and the width w of the tumor were recorded duringthe period of experiment and the volume of tumor wascalculated v  lw2 2', ' at last the tumors were harvestedweighed and photographed', ' body weight of mice wasalso detected every 3 d and survival curve was drawncorrespondingly', '2', '12', 'evaluation of antiangiogenetic efficacythe antiangiogenetic therapy efficacy of the polywraplex thefour groups saline naked sirna polyplex and polywraplexwas measured by calculating the density of blood capillaries', 'the capillaries of tumor slides of each group were stainedwith rabbit anticd 31 antibodies', 'fig', ' 1  schematic diagram of the process of unimolecular polyplex formulation and the subsequent utilization as a core toobtain assembled polywraplex encapsulated by triblock copolymers', '2', '13', 'statistical analysisthe data of each group collected were analyzed by twowayttest using originpro 2017 software', ' the value of  p  0', '01 p  0', '001 was considered as statistically significance fig', ' 1', 'results3', '1', 'synthesis of network cationic polymer throughthermodynamically interlocked methoda thermodynamically interlocked method was utilizedto construct a network cationic polymer which waspolymerized by condensing pamam and oligospermineimidazolediimine through imine which was phresponsiblein biological condition according to previously study 17', ' theoligospermineimidazolediimine was condensed by mixingimidazole45 dicarbaldehyde and spermine in a mole ratio54 for 12 h', ' at the end of the reaction the generation of zetapotential around the network cationic polymer would prohibitadditional cationic materials from further polymerizinggiving rise to a thermodynamic interlocked method followingwhich a network cationic polymer of the mean particlediameter of 408 nm was thermodynamically synthesized', 'similarity of the structure to dendrimers with increasing indiameter the molecular weight mw doubles the mwof pamam dendrimer 6 generation was 58048 dalton anddiameter was 6', '7 nm the mw of network cationic polymerwas high approximately tens of millions dalton and couldntbe detected accurately using the molecular weight analysismethod sizeexclusion chromatography', ' the hnmr of thenetwork cationic polymer dmsod6 ppm 8', '458', '38 mfig', ' 2  the structure characterization of the networked cationic polymer polyplex and polywraplex', ' a 1hnmr ofnetworked cationic polymer b image of agarose electrophoresis of polyplex in a series of the mass ratio ofsirnanetworked cationic polymer c particle size and zeta potential of polyplex upon addition of sirna into thenetworked cationic polymer d change of particle size and zeta potential during formulating polywraplex', 'nh 8', '067', '73 m arh 3', '562', '16 m ch2ch2 is asshown in fig', ' 2a', '3', '2', 'formation and characterization of polyplex andpolywraplexas shown in fig', ' 2b the image of the electrophoresis indicatedthat cationic polymer could condense the sirna completelywhen mass ratios of network cationic polymersirna weremore than 11', ' as shown in fig', ' 2c the particle shrank fromits maximum size at 408 to 81 nm as sirna was graduallydropping to the polymer solution in the mass ratio from120 to 15', ' then the diameter regained to near 200 nmafter continuously adding sirna', ' the shrinkage of particleswas attributed to the sirna encapsulated into the cationicpolymer by the electrostatic forces', ' when a charged particlecollapsed to a smaller size due to neutralization or partialneutralization the oppositely charged species must be locatedinside the particle', ' after that upon further addition of sirnathe particle gradually rebounded to near 200 nm which wasinitiated by the condensation ability of the cationic polymerbeing saturated no further the sirna could enter into them', 'meanwhile the decrease of zeta potential gradually deprivedstability of the individual particles in solution inducing theinterparticulate condensation', 'the core of polywraplex was constructed using polyplexwcationic polymer wsirna  71 since the mrna expressionsuppression of polyplex was optimum in the mass ratio at71 shown in fig', ' 5b and the diameter was about 100 nmshown in fig', ' 2c which was prone to enhanced permeabilityand retention epr effect 19', ' the mass ratio of triblockcopolymercationic polymer ww  121 was used to surfacelayer of formulated polywraplex because that the surfaceof particle presented neutralization shown zeta potentialdecreased to 0 mv in fig', ' 2d', ' the decreased reason of zetapotential was due to the surface positive charge of polyplexneutralized by excessive negative charged triblock copolymeraccording to previous studies in this project 18', 'as the image of tem shown in fig', ' 3a the networkedcationic polymer was connected with the black crosslinkingjunction on the tem photograph indicating that thewhole polymers were consisted of branched pamam g6and the linear oligospermineimidazole45diimine toform networked structure', ' as shown in fig', ' 3b the imagedemonstrated that the polyplexes in the mass ratio of 71could condense the sirna effectively', ' under the 0', '5 μm scalepolyplexes were wellformed spherical with a particle sizeof about 100 nm', ' the tem image of polywraplexes showedthat morphology of the particle was near sphere and the sizeat about 200 nm larger than polyplexes as shown in fig', ' 3c', 'both of the particles sizes were less smaller than dls datashown in fig', ' 2c and 2d since dls detects the hydrodynamicsize of particle which is swollen in water condition comparedto the dried state of tem sample meanwhile the asymmetricsurface monolayer of polywraplex with low electronic densitywas not clearly visible by tem', '3', '3', 'serum stability of polyplex and polywraplexas shown in fig', ' 4a', ' the image of the electrophoresis agarosegel demonstrated that the degradation time of the sirnain polyplex is consistency with naked sirna was about6 h for positive polyplexes are believed to induce stronginteraction with the compositions in the fbs for which maylose the ability to protect the sirna 18', ' when sirna amidpolywraplex it could be detected until 48 h since the surfacetriblock copolymer membrane could play the role of guardianto avoid degrading in serum', '3', '4', 'determination of intracellular uptake efficiency ofpolyplex and polywraplex in u87mg cells using flowcytometrythe intracellular uptake efficiency of the polyplexes andpolywraplexes in u87mg cells was measured using flowcytometry', ' as shown in fig', ' 4b the uptake efficiency ofpolyplexes in different mass ratios from 71 to 151 wasalmost the same with pei 25 k group which was the goldstandard of gene nonviral vector but owned high cytotoxicity', 'when fbs excised in the medium shown in fig', ' 4c the uptakeefficiency of polyplex was lower than polywraplex', ' the nearly30 ev cationic charges of the naked polyplexes were believedto induce strong interaction with the proteins in the fbs forwhich may compromise the polyplexes to interact with thetarget cells', ' in the case of polywraplexes since the surfacecharges were neutralizedcovered by the triblock copolymermembrane the particles had better accessibility with thetarget cells', '3', '5', 'intracellular distribution of the polyplex andpolywraplex using clsmthe intracellular distribution of the polyplex and thepolywraplex was measured using clsm', ' as shown in fig', ' 4dthe red dots cy3labeled sirna polyplex can overlap with thegreen dots lysotrack green labeled lysosomes indicatingthat polyplexes were successfully uptaken by the u87mgcells in the fbs free medium', ' at the same time polywraplexcould transfect sirna more effectively than polyplex in thefbs 10 medium', ' the cy3labeled sirnas were presented inthe cytoplasm which was the destination for them to playthe role of silence instead of cell nucleus', ' the results indicatethat the polywraplex can protect sirna from degrading andcan effectively take sirna into the cytoplasm', ' these resultswere consistent with the data of cellular uptake experiment', '3', '6', 'cytotoxicity of the network cationic polymeras shown in fig', ' 5a cytotoxicity of the network cationicpolymer was tested through the viability of u87mg cellstreated with a serious concentration of the polymers', ' whilepei 25 k was as positive control the viability of the networkedcationic polymer was higher than pei 25 k in u87mg cellsin concentration from 20 to 300 μgml', ' the differentiation ofcytotoxicity of two polymers may be due to the componentsof the cationic polymer which was linked with phsensitivefig', ' 5  a viability of u87mg cells treated with the networked cationic polymer b gene knockdown efficiency of polyplexin fbs free dmem medium contained sirna was 1 μgwell c gene knockdown efficiency of polywraplex in dmemmedium with fbs 10 contained sirna was 1 μgwell d the nir image of tissue distribution in tumorbearing nude miceadministrated systemically after 24 h of each group a naked sirna b cy5sirna polyplex and c cy5sirna polywraplex', 'chemical bonds relative to the pei which was linked morestably in low ph environments 5', '3', '7', 'determination of vegfa gene silencing of polyplexand polywraplex in u87mg cells using qpcrwhen polyplexes formed in a series of mass ratio wereused to transfect vascular endothelial growth factor asilence sirnaantivegfa sirna into u87 mg cells theone wcationic polymer wsirna  71 showed the higher silenceability at lower mass ratio than the other groups in fbs freemedium shown in fig', ' 5b', ' so this mass ratio was selectedto construct the next step formulation polywraplex', ' in the10 fbs medium polywraplex demonstrated more efficientlysilencing effect compared to other groups as shown infig', ' 5c', ' the results indicated that the polywraplex coatedwith surface triblock copolymer could prevent sirna fromdegrading and transfect the gene into the u87mg cells whichwere consistent with intracellular uptake and distributionexperiment', '3', '8', 'distribution of cy5labeled sirna in vivoeach of sirna formulation demonstrated different organtargeted affinity shown in fig', ' 5d', ' naked sirna was prone toaccumulating and clearing in kidney since its particle size lessthan 10 nm could pass the glomerular filtration', ' the cationicpolyplex mainly accumulated in liver for its particle sizeabout 100 nm according to epr effect', ' the polywraplex groupshowed the most fluorescent intensity in tumor than theother groups because that its neutralized and pegstabilizedsurface were facilitated to be trapped by tumor according toepr effect', '3', '9', 'in vivo tumor suppressionas shown in fig', ' 6a polywraplex group demonstratedsignificant difference compared to saline group and nakedsirna group owning the largest reduction in volume of thetumor', ' the body weight curve of mice in fig', ' 6b shows that thedifferentiation of each group is not significant and no micedied during the experiment', ' as shown in fig', ' 6c and 6d boththe weight and images of tumors from polywraplex groupshowed the lowest volume in all experiment groups whichindicated that the polywraplex sirna system can efficientlydeliver the sirna to the tumor tissues', ' the average tumorrelative weights for the four experiment groups were 10091 67 and 39 respectively shown in fig', ' 6c', ' the resultsindicated that polywraplex with triblock surface membranecould more efficiently deliver to tumor which was consistentwith sirna distribution experiment in vivo', '3', '10', 'evaluation of antiangiogenetic efficacythe antiangiogenetic efficacy of polywraplex loading antivegf sirna was evaluated by calculating the nascentcapillary density', ' as shown in fig', ' 7a the microscopic imagesof tumor slides which stained with cd31 antibody form eachgroup of mice receiving the four dosage forms respectivelythe capillary densities decreased significantly in polywraplexgroup compared to saline naked sirna and polyplex groups', 'the average capillary densities of tumor slides for the fourgroups were 169 161 101 and 47 spotsslides respectivelywhich were equivalent to 100 95 59 and 27 as shownin fig', ' 7b', ' the results are more remarkable than the order oftumor weight experiment shown in fig', ' 6c', ' antivegfa sirnadirectly inhibits tumor angiogenesis consequently lead tofig', ' 6  results of antitumor effect of u87mg tumorbearing nude mice in vivo injection dosage of each mouse was0', '5 mgkgtime', ' a growth volume curves of xenograft tumor b body weight and survival curves of mice c relativetumor weight data and d photos of u87 mg tumors of each group a saline b naked sirna c polyplex d polywraplex', 'meansd n  6', 'fig', ' 7  a images of tumor sections stained by cd 31 antibody from four experiment group a saline b naked sirna cpolyplex d polywraplex and b quantification of capillaries of tumor', ' meansd n  5', '  p  0', '01  p  0', '001', 'a decrease of tumor weight and volume which induced thedifferentiation between capillary density and tumor weightexperiment', '', '', 'in constructing sizecustomizable unimolecular polyplexreplacing the low molecular weight branched pei withdendrimers as the crosslinking junctions of the networkedcationic polymer may offer a betterdefined structureand electron microscopic visibility without changing thechemistry', ' the zeta potentialregulated polymerization selfterminated at predetermined size the formed networkedcationic polymer packed sirna intramolecularly to form aunimolecular polyplex and the cationic particle adsorbedrationally designed triblock copolymer to form a monolayer', 'biologic assays comprising polyelectrolytes induced sirnaleaking enzymatic degradation and gene silencing activityin vitro and in vivo confirmed the functional similarity of thisdelivery carrier to that with pei as the polymer crosslinkingjunctions', ' the polywraplexes using dendrimer as the cationicpolymer crosslinkers may serve a useful model to feedbackthe construction processes of synthetic carriers and alow generation dendrimer cationic polymer may serve asformulation component', 'acknowledgmentsthese authors g', 'b', ' performed the research g', 'b', ' and t', 'x', 'drafted the manuscript f', 'w', ' conceived the research designedthe experiments together with g', 'b', ' and t', 'j', ' u', 'k', 'c', ' revised themanuscript j', 'f', ' xt', 'd', ' provided help in synthesis and animalexperiment', ' this study was financially supported by thegrant of the natural science foundation of china grant nos', '81373352 and 81690262', ' the authors appreciate the generoushelp from the faculties of the analytical center of shanghaijiao tong university', '', '', '1 chen y gao dy huang l', ' in vivo delivery of mirnas forcancer therapy challenges and strategies', ' adv drug delivrev 20158112841', '2 juliano rl', ' the delivery of therapeutic oligonucleotides', 'nucleic acids res 20164414651848', '3 li z rana tm', ' therapeutic targeting of micrornas currentstatus and future challenges', ' nat rev drug discov201413862238', '4 pack dw hoffman as pun s stayton ps', ' design anddevelopment of polymers for gene delivery', ' nat rev drugdiscov 20054758193', '5 duan sy ge xm lu n wu f yuan we jin t', ' syntheticpolyspermine imidazole45amide as an efficient andcytotoxicityfree gene delivery system', ' int j nanomedicine20127381322', '6 santiagoortiz jl schaffer dv', ' adenoassociated virus aavvectors in cancer gene therapy', ' j control rel2016240287301', '7 liu y siriwon n rohrs ja wang p', ' generation of targetedadenoassociated virus aav vectors for human genetherapy', ' curr pharm des 20152122324856', '8 blessing d deglon n', ' adenoassociated virus and lentivirusvectors a refined toolkit for the central nervous system', ' curropin virol 201621616', '9 yin h kanasty rl eltoukhy aa vegas aj dorkin jranderson dg', ' nonviral vectors for genebased therapy', ' natrev genet 201415854155', '10 slita a egoroua a casals e casalsa e kiselev arosenholma jm', ' characterization of modified mesoporoussilica nanoparticles as vectors for sirna delivery', ' asian jpharm sci 20181365929', '11 whitehead ka dorkin jr vegas aj chang ph veiseh omatthews j et al', ' degradable lipid nanoparticles withpredictable in vivo sirna delivery activity', ' nat commun201454277', '12 lv h zhang s wang b cui s yan j', ' toxicity of cationic lipidsand cationic polymers in gene delivery', ' j control rel200611411009', '13 hong ca eltoukhy aa lee h langer r anderson dgnam ys', ' dendrimeric sirna for efficient gene silencing', 'angew chem int ed 2015542367404', '14 liu j song l liu s zhao s jiang q ding b', ' a tailored dnananoplatform for synergistic rnaichemotherapy ofmultidrugresistant tumors', ' angew chem int ed201857471548690', '15 dowdy sf', ' overcoming cellular barriers for rnatherapeutics', ' nat biotechnol 20173532229', '16 feng j chen s ge xm wu f bai g jin t', ' precise assembly ofsynthetic carriers of sirna through a series of interlockedthermodynamically selfregulated processes', ' adv functmater 20182861703207', '17 duan s yuan w wu f jin t', ' polyspermineimidazole45imine a chemically dynamic and biologicallyresponsive carrier system for intracellular delivery of sirna', 'ange chem int ed 20125132793841', '18 ge xm duan sy wu f feng j zhu h jin t', ' polywraplexfunctionalized polyplexes by postpolyplexing assembly of arationally designed triblock copolymer membrane', ' advfunct mater 20152527435263', '19 maeda h wu j sawa t matsumura y hori k', ' tumorvascular permeability and the epr effect in macromoleculartherapeutics a review', ' j control rel 2000651227184', '', ''], 'Asymptomatic Carrier State  Acute Respiratory Disease': ['journal of microbiology immunology and infection 2020 53 404e412asymptomatic carrier state acuterespiratory disease and pneumonia due tosevere acute respiratory syndromecoronavirus 2 sarscov2 facts and mythschihcheng lai a yen hung liu b chengyi wang byahui wang c shunchung hsueh d muhyen yen efwenchien ko g poren hsueh hi', 'since the emergence of coronavirus disease 2019 covid19 formerly known as the 2019 novel coronavirus 2019ncov in wuhan china in december 2019 which is caused by severe acute respiratory syndrome coronavirus 2 sarscov2 more than 75000 cases have been reported in 32 countriesregions resulting in more than 2000 deaths worldwide', ' despite the fact that most covid19 cases and mortalities were reported in china the who has declared this outbreak as the sixth public health emergency of international concern', ' the covid19 can present as an asymptomatic carrier state acute respiratory disease and pneumonia', ' adults represent the population with the highest infection rate however neonates children and elderly patients can also be infected by sarscov2', ' in addition nosocomial infection of hospitalized patients and healthcare workers and viral transmission from asymptomatic carriers are possible', ' the most common finding on chest imaging among patients with pneumonia was groundglass opacity with bilateral involvement', ' severe cases are more likely to be older patients with underlying comorbidities compared to mild cases', ' indeed age and disease severity may be correlated with the outcomes of covid19', ' to date effective treatment is lacking however clinical trials investigating the efficacy of several agents including remdesivir and chloroquine are underway in china', ' currently effective infection control intervention is the only way to prevent the spread of sarscov2', '', 'coronavirus 2019ncov sarscov2 covid19 asymptomatic carrier', 'in december 2019 an outbreak of pneumonia due to unknown cause occurred in wuhan china and rapidly spreadthroughout the country within 1 month', ' the pathogen ofthis disease was confirmed as a novel coronavirus by molecular methods and was initially named as 2019 novelcoronavirus 2019ncov however the world health organization who announced a new name on february 112020 for the epidemic disease corona virus diseasecovid19', ' to date covid19 has affected people in morethan 28 countriesregions including taiwan and hasbecome a global threat', '1e4 in addition the coronavirusstudy group of the international committee on taxonomyof viruses has renamed the virus which was provisionallynamed 2019ncov as severe acute respiratory syndromecoronavirus2 sarscov2 based on phylogeny taxonomyand established practice', '5 prior to this on january 302020 the who declared the covid19 outbreak as the sixthpublic health emergency of international concern therefore this outbreak constitutes a public health risk throughthe international spread of disease and requires a coordinated international response', ' increased dissemination ofinformation through use of the internet is associated withincreased transmission of information from all geographicalregions and across disciplines regarding recognition ofsarscov2 and covid196 nevertheless important factorsassociated with covid19 specifically age and sex distribution incubation period clinical features and optimaltreatment remain uncertain', ' therefore herein we performed a literature review focusing on the epidemiologicalcharacteristics and clinical manifestations of covid19including asymptomatic carrier state acute respiratorydisease ard and pneumonia', '', 'severity of covid19covid19 was defined as the respiratory disease caused bysarscov2 that emerged in china in 2019 httpswww', 'who', 'intwesternpacificemergenciescovid19', 'theclinical manifestations of covid19 are protean whichinclude asymptomatic carrier ard and pneumonia ofvarying degrees of severity', ' first asymptomatic cases werediagnosed based on positive viral nucleic acid test resultsbut without any covid19 symptoms such as fevergastrointestinal or respiratory symptoms and no significant abnormalities on chest radiograph78 however thetransmission of covid19 through asymptomatic carriers viapersontoperson contact was observed in many reports', '47910 second patients with ard defined aslaboratoryconfirmed covid19 cases had respiratorysymptoms however chest computed tomography ct didnot reveal signs of pneumonia', '11 third patients withpneumonia defined as covid19 cases had both respiratorysymptoms and pneumonia on chest radiograph', ' this category includes severe pneumonia e either respiratory rate30minute spo2  93 or pao2fio2  300 mmhg and acritical condition characterized by respiratory failurerequiring mechanical ventilation shock or other organfailure requiring icu management', '8epidemiologyas of february 21 2020 data from the who revealedaltogether 76769 cases of covid19', '1 thirtytwo countriesor regions have reported confirmed cases including mainland china japan singapore hong kong special administrative region sar thailand south korea taiwanaustralia malaysia germany vietnam the united statesmacao sar the united arab emirates canada france thephilippines the united kingdom italy india russiafinland sweden sri lanka cambodia nepal spainbelgium iran egypt israel and lebanon', ' in addition 643cases were found in international conveyance e diamondprincess', ' china has the largest number of patients withcovid19 n z 75543 followed by south korea n z 204japan n z 93 and singapore n z 85', ' to date the reported number of deaths is 2247 and only 11 occurredoutside of mainland china including two each in hong kongspecial administrative regions sar iran and diamondprincess and one each in taiwan south korea japanphilippines and france', ' however asymptomatic patientsor patients with mild covid19 symptoms may not seekhealth care nor receive diagnosis which leads to underestimation of the burden of covid19', 'age and sexinitially most reported covid19 cases in wuhan wereadult patients however all of these cases had pneumonia', '12e14 their median or mean ages were 55', '5 49', '0 and40656 years in three separate studies', '12e14 a similar findingwas observed in two recent nonpeerreviewed studies onestudy with 1099 patients from 552 hospitals in 31 provincesin china in which the median age was 47', '0 years and55', '1 of the patients were between the ages of 15e49years and a second study that included 4021 confirmedcases in 30 provinces of china in which the mean age was49 years and 50', '7 of patients were between the ages of20e50 years', '1115 both these studies included ard andpneumonia cases', '1115 similarly the novel coronaviruspneumonia emergency response epidemiology team inchina reported that 66', '7 n z 29798 of 44672 cases ofcovid19 of varying degrees of severity were between 20and 60 years of age', '8 in korea ryu et al', ' found that theinitial 15 cases were aged between 25 and 62 years', '16regarding elderly patients infected with sarscov2 onestudy showed that 14', '6 6 in 41 of patients were aged 65years13 while another study showed that 15', '2 15 in 99patients were aged 70 years among pneumonia cases', '12in addition two nonpeerreviewed studies showed only153 15', '1 patients were elderly patients aged 65years11 and 407 10', '1 patients were aged 70 years', '15according to the recent china cdc report8 12', '0n z 5326 of patients were aged 70 years', ' regardingchildren with covid19 nine 0', '9 patients aged 0e14years were found in only one study11 while 14 0', '35 patients were aged 10 years in another study', '15 the largeststudy in china showed that 0', '9 n z 416 of patients wereaged 10 years', '8 further wei et al', ' reported that nineinfants under 1 year of age were infected with sarscov2in china', '8 regarding patient sex ratio male sex comprisedmore than half of the cases in most covid19 studies11e14and the proportion of males ranged from 51', '4 to73', '2', '811e1416initially approximately half of the cases had huananseafood market exposure and animaltohuman transmission was suspected', '1213 however fewer cases hadexposure to this seafood market and an increasing numberof cases demonstrated humantohuman transmission', '1117fortunately no evidence was found for intrauterine infection caused by vertical transmission in women who contracted covid19 pneumonia in late pregnancy', '18 inaddition to family cluster infections due to humantohuman transmission19 nosocomial spread of sarscov2 isa serious concern', ' indeed one study in a zhongnan hospitalof the wuhan university showed 29', '0 n z 40 weremedical staff and 12', '3 n z 17 contracted covid19during hospitalization', '14 two other studies showed that2', '1 n z 23 and 3', '8 n z 1716 of patients were healthworkers', '811risk factorsalthough the risk factors of covid19 remain unclear manystudies reported that a significant proportion of patientshad underlying conditions', '811e14 for patients with sarscov pneumonia chen et al', ' showed that 50', '5 n z 51of patients had chronic medical illness namely cardiovascular and cerebrovascular diseases 40', '4', '12 among 1099patients with sarscov2 ard guan et al', ' showed that23', '2 n z 255 of patients had at least one coexistingc', 'c', ' lai et al', 'disorder and hypertension was the most common underlying disease 14', '9 followed by diabetes mellitus7', '4', '11 another large study on covid19 cases of varyingdegrees of severity also showed that hypertension was themost common underlying disease n z 2683 12', '8 followed by diabetes mellitus n z 1102 5', '3 and cardiovascular disease n z 873 4', '2', '8 moreover patients withsevere covid19 were more likely to have comorbiditiesthan those with nonsevere diseases 37', '6 vs', ' 20', '5p  0', '001', '11 a similar trend was observed in another studyof 138 hospitalized patients with sarscov2 pneumonia inwhich 46', '4 n z 64 of patients had comorbidities and theintensive care unit icu patients were more likely to haveunderlying diseases compared to nonicu patients 72', '2vs', ' 37', '3 p  0', '001', '14in summary these studies disclosed several significantfindings', ' first although most patients with covid19 weremiddleaged adults elderly patients and children alsocontracted covid19', ' second there is a higher prevalenceof men with covid19 than that of women howeverfurther studies are warranted to confirm this finding', ' thirdhealth care workers and hospitalized patients could beinfected by sarscov2 in the hospital setting', ' finally atleast 20 of covid19 cases had underlying diseases andmore severe cases were more likely to have comorbiditiesthan nonsevere cases', 'incubation periodit is essential to know the incubation period the timeelapsing between the moment of exposure to an infectiousagent and the appearance of signs and symptoms of thedisease for infection control and guidance for the durationof isolation', ' initially li et al', ' used the data on exposureamong 10 confirmed cases in wuhan to estimate the meanincubation period which was 5', '2 days 95 confidence interval ci 4', '1e7', '0 the 95th percentile of the distributionwas 12', '5 days 95 ci 9', '2e18', '20 one estimation based on125 patients with clearly defined exposure periods in chinaindicated that the median incubation period was 4', '75interquartile range 3', '0e7', '2 days', '15 using the travel history and symptom onset of 88 confirmed cases that weredetected outside of wuhan in the early outbreak phasebacker et al', ' estimated that the mean incubation periodwas 6', '4 days 95 credible interval 5', '6e7', '7 ranging from2', '1 to 11', '1 days 2', '5th to 97', '5th percentile', '21 howeverguan et al', ' using a large sample for estimation suggestedthat the median incubation period was only 3', '0 days butcould be as long as 24 days', '11 overall these estimates willbe refined as more data become available', ' detailedepidemiological information based on a larger sample ofpatients infected with covid19 is needed to determine theinfectious period of sarscov2 as well as to determinewhether transmission can occur from asymptomatic individuals during the incubation period', 'clinical manifestationsprevious reports revealed that there are asymptomaticpatients infected with sarscov2', '7822 these patients canspread the virus and may represent a population that cancoronavirus 2 sarscov2 facts and myths407be easily neglected in epidemic prevention', ' therefore it isimportant to identify asymptomatic patients with covid19', ' since these patients are asymptomatic careful monitoring of the natural course of the disease and contacthistory may only identify them', ' based on the current datawe do not know whether these patients are only asymptomatic initially after contracting the disease or if they areasymptomatic throughout the course of the disease', 'among a pooled analysis of 970 patients with ard table1 based on two studies with detail clinical characteristics1123 males comprised more than half of the patientsand the mean age was 45 years', ' hypertension was the mostdata are n  nn  and mean sd', 'copd chronic obstructive pulmonary disease ecmo extracorporeal membrane oxygenation na not available', 'common underlying disease followed by diabetes mellitus', 'approximately twothirds of patients had cough but only44', '7 patients had fever', ' in addition sputum productionwas observed in onethird of patients and sore throat wasfound in 14', '0 of patients', ' only fewer than 5 of patientshad gastrointestinal symptoms such as diarrhea nauseaand vomiting', ' meanwhile 32', '4 of patients required oxygen therapy but none required mechanical ventilation', 'only one patient with ard died and the mortality rate was0', '1', 'among a pooled analysis of 468 patients with pneumoniatable 2 based on five studies with detailed description ofclinical features of the disease11e1423 male sex comprised60', '3 of patients and the mean age was 53 years', ' approximately onefifth of patients reported smoking history', 'hypertension was the most common underlying disease20', '5 followed by diabetes mellitus 14', '4', ' additionally 76', '3 of patients had fever and 70', '5 of patientspresented cough', ' furthermore dyspnea and sputum production were observed in approximately onethird of patients', ' moreover 8 and 6 of patients had nauseavomiting or diarrhea respectively', ' in all 70', '9 of patientsrequired oxygen therapy and 28', '8 required mechanicalventilation', ' moreover 5', '1 and 3', '1 of patients requiredrenal replacement therapy and extracorporeal membraneoxygenation respectively', ' the overall mortality was 8', '2n z 37 however 313 66', '9 patients remainedhospitalized', 'furthermore patients with pneumonia were older witha higher prevalence of smoking history more underlyingdiseases and were more likely to have fever myalgiafatigue dyspnea headache and nauseavomiting comparedto patients with ard all p  0', '05 table 3', ' in additionpneumonia cases presented a higher white blood cell countand neutrophil count but had a reduced leukocyte countcompared to ard cases', ' serum procalcitonin levels of0', '5 ngml were found in 6', '1 69912 7', '7 33913 to13', '7 1611711 among sarscov2 pneumonia patientsreported from three studies', '11e13 moreover patients withpneumonia were more likely to require oxygenation therapy mechanical ventilator renal replacement and extracorporeal membrane oxygenation and received moreantibiotics and antiviral therapy than patients with ard', 'finally pneumonia was associated with a higher mortalityrate than ard p  0', '0001', 'imagebased on the findings of 1099 ard cases of covid only14', '7 n z 162 of patients had an abnormal chest radiograph', '11 in contrast 840 76', '4 patients had abnormal anddiverse chest ct images in which groundglass opacityggo was the most common abnormality n z 550 65', '5followed by local patchy shadowing n z 409 48', '7 andinterstitial abnormalities n z 143 17', '0', ' in addition 50550', '1 had bilateral involvement', '11 the predominance ofggo and bilateral involvement in chest ct is consistentwith previous studies', '24e26 in contrast other types of abnormalities such as cavitation pleural effusion andlymphadenopathy were not found', '2427 as the diseaseprogressed followup ct showed enlargement andc', 'c', ' lai et al', 'data are n  nn  and mean sd', 'copd chronic obstructive pulmonary disease ecmo extracorporeal membrane oxygenation na not available', 'consolidation of single ggo an enlarged fibrous stripe andsolid nodules', ' in contrast a small fibrous stripe as well asthe resolution of ggo may be associated with improvement in the patients condition', '2829treatmentseveral reports suggest the following as potential drugcandidates although the clinical effectiveness of thesedrugs have not yet been evidenced for covid19 lopinavirritonavir kaletra nucleoside analogs neuraminidaseinhibitors remdesivir umifenovir arbidol dna synthesisinhibitors such as tenofovir disoproxil and lamivudinechloroquine ace2based peptides 3clike protease3clpro inhibitors novel vinylsulfone protease inhibitorteicoplanin and chinese traditional medicine such asshufengjiedu or lianhuaqingwen capsules', '30e39 theeffectiveness of remdesivir is more evident in the literatureto date indeed it appears to be the most promising drugfor covid19', ' in fact an in vitro study demonstrated thatthe 50 effective concentration ec50 of remdesivir againstncov2019betacovwuhanwiv042019 in vero e6 cellswas 0', '77 mm and the 90 effective concentration ec90was 1', '76 mm', '31 however only one case in the us showed aclinical response to remdesivir although the viral loadappeared to decline at the time of initiating remdesivircycle threshold from 18e20 to 23e24', '33 subsequentlytwo large clinical trials nct04252664 httpsclinicaltrials', 'govct2shownct04252664formildmoderatecovid19andnct04257656httpsclinicaltrials', 'govct2shownct04257656forseverecoronavirus 2 sarscov2 facts and myths409data are n  nn  and mean sd', 'copd chronic obstructive pulmonary disease ecmo extracorporeal membrane oxygenation na not available', 'bold indicates p  0', '05', 'covid18 were initiated in china with an estimated enddate in early april 2020', ' in these two trials the 10dayregimen of remdesivir was 100 mg once daily for 9 daysafter the loading of 200 mg on day 1', '34 chloroquine isanother promising drug', '3536 an in vitro study on the timeofaddition assay in vero e6 cells demonstrated that chloroquine functioned at both entry and at postentry stagesof covid19 and the ec90 value of chloroquine against the2019ncov was 6', '90 mm', '31 in addition passive immunizationtherapy and the use of interferon could theoretically behelpful but to date there is no evidence to validate thishypothesis', 'systemic corticosteroid was administered in 18', '6e44', '9 patients in order to control the inflammatoryresponse caused by sarscov2 in 4 initial large studies', '11e14 however corticosteroid therapy could be associated with delayed merscov rna clearance adjustedhazard ratio 0', '35 95 ci 0', '17e0', '72 p z 0', '005 for critically ill patients with mers40 and early corticosteroidtreatment could be associated with higher subsequentplasma rna load of sarscov for adults with sars', '41moreover corticosteroidassociated psychosis and diabetes were observed in the treatment of sars', '4243 thusclinical use of corticosteroids in the treatment of covid19was not recommended in the interim unless indicated foranother reason', '4445outcomesaccording to who reports the overall mortality rate forcovid19 was 2', '9 2247 in 767691 however the mortality rate varied among studies', ' initial studies reportedthat the mortality rate associated with sarscov2 pneumonia ranged from 1112 to 1513 but later studiesrevealed that the mortality rate was between 1', '411 and4', '3', '14 the differences in the results among differentstudies could be due to the study population as well as thedifferences among the studies in terms of disease severity', 'in addition these results need further clarification since amajority of the reported mortality was allcause mortalitynot covidattributed mortality also the outcome measurement was incomplete because many patients remainedhospitalized before publication of the results', 'several prognostic factors of covid19 were also reported in these studies', ' in one study using the mulbstascore system46 which includes six indices namely multilocular infiltration lymphopenia bacterial coinfectionsmoking history hypertension and age revealed thatthese indices were poor prognostic factors', '12 another studyshowed similar findings and specifically the indicators ofdisease severity including oxygenation respiratory rateleukocytelymphocyte count and the chest imaging findings were associated with a poor clinical outcome', '11moreover a substantially elevated casefatality rateincluded the following patient characteristics male sex60 years of age baseline diagnosis of severe pneumoniaand delay in diagnosis', '15 similarly the china cdc reportedthat patients aged 80 years had the highest case fatalityrate 14', '8 among different age groups and the case410fatality rate of patients in which disease severity wascritical was 49', '0', '8 together these findings suggest thatold age and increased disease severity could predict a pooroutcome', 'in this stage of lack of effective drugs the implementation of infection control interventions and trafficcontrol bundle to effectively limit droplet contact andfomite transmission is the only way to slow the spread ofthe sarscov2', ' these infection control interventionsinclude early identification of cases and their contactsavoiding close contact with people with airway symptomsappropriate hand washing and enhanced standard infection prevention and control practices in the healthcaresetting', '4748uncertain issuesalthough information on covid19 has increased rapidlysince the emergence of sarscov2 many issues remainunresolved', ' first the clinical manifestation of covid19ranges from the asymptomatic carrier state to severepneumonia however most early reports only showed thefindings of sarscov2 pneumonia in which the ratio ofmale patients was much larger than that of female patients there were no pediatric cases and the mortalityrate was high', '12e14 subsequent to the publication of thestudies of patients with only ard or mild pneumonia wefound the ratio of maletofemale patients decreasedchildren or neonates could contract covid19 and themortality rate declined compared to that of previous reports', '811 however whether children were less susceptibleto sarscov2 or their presentation was mostly asymptomatic or difficult to detect remains unclear', '49 in addition most studies especially those with a large patientpopulation were conducted in china and the study ofasymptomatic carriers was limited', ' more studies areneeded to clarify the epidemiologic characteristics ofcovid19 and to identify the risk and prognostic factors ofpatients infected with sarscov2', ' second zou et al', ' reported that the viral load detected in asymptomatic patients was similar to that found in symptomatic patientshowever the viral loads from patients with severe diseaseswere higher than those in patients with mildtomoderatepresentations', ' moreover higher viral loads were detectedin the nose than in the throat', '50 as there is a concern ofvirus spread due to severe cough induced by performing athroat swab nasal swab may be a relatively safe and sensitive alternative to collect the respiratory specimen ofpatients with covid19', ' however this study involved apopulation of only 18 patients including one asymptomaticpatient', '49 in addition every test has its own limitation andsensitivityspecificity however the studies investigatingthe performance of current diagnostic methods of sarscov2 among different covid19 populations includingasymptomatic carriers ard and pneumonia are lacking', 'the false positive and negative rates of each diagnostic toolamong patients with covid19 presenting varying degreesof severity of the disease remain unknown', ' this type ofinformation is important for screening patients with covid19 and to aid isolation and infection control strategies', 'finally since sarscov2 can be detected in thec', 'c', ' lai et al', 'asymptomatic individual the prophylactic or preemptiveuse of effective antiviral agents to reduce the viral loadand decrease the risk of virus spread from asymptomaticcarriers may help to control the spread of covid19', '', 'this review provides updated information about covid19', 'sarscov2 can affect patients of all ages', ' covid19 canpresent as asymptomatic carriage ard and pneumonia', 'severe cases are more likely to be older and to haveincreased underlying comorbidities compared to mildcases', ' age and disease severity can be correlated with theoutcomes of covid19', ' to date effective treatment forsarscov2 is lacking however two trials investigating theclinical efficacy of remdesivir are underway in china', 'currently effective infection control intervention is theonly way to prevent the spread of sarscov2', '', '', '1', ' who', 'httpswww', 'who', 'intdocsdefaultsourcecoronavirusesituationreports20200221sitrep32covid19', 'pdfsfvrsnequals4802d0892', ' accessed on 21 february 2020', '2', ' lee pi hsueh pr', ' emerging threats from zoonoticcoronavirusesfrom sars and mers to 2019ncov', ' j microbiolimmunolinfect202053365e7', 'httpsdoi', 'org10', '1016j', 'jmii', '2020', '02', '001', '3', ' huang wh teng lc yeh tk chen yj lo wj wu mj et al', '2019 novel coronavirus disease covid19 in taiwan reportsof two cases from wuhan china', ' j microbiol immunol infect202053481e4', ' httpsdoi', 'org10', '1016j', 'jmii', '2020', '02', '009', '4', ' liu yc liao ch chang cf chou cc lin yr', ' a locally transmitted case of sarscov2 infection in taiwan', ' n engl j med2020 feb 12', ' httpsdoi', 'org10', '1056nejmc2001573', '5', ' gorbalenya ae baker sc baric rs de groot rj drosten cgulyaeva aa et al', ' severe acute respiratory syndromerelatedcoronavirus the species and its viruses e a statement of thecoronavirus study group', ' 2020', ' 2020', '02', '07', '937862', '6', ' lai cc shih tp ko wc tang hj hsueh pr', ' severe acuterespiratory syndrome coronavirus 2 sarscov2 and coronavirus disease2019 covid19 the epidemic and the challenges', ' int j antimicrob agents 2020 feb 17', ' httpsdoi', 'org10', '1016j', 'ijantimicag', '2020', '105924', '7', ' bai y yao l wei t tian f jih dy chen l et al', ' presumedasymptomatic carrier transmission of covid19', ' j am medassoc 2020 feb 21', ' httpsdoi', 'org10', '1001jama', '2020', '2565', '8', ' the novel coronavirus pneumonia emergency responseepidemiology team', ' the epidemiological characteristics of anoutbreak of 2019 novel coronavirus disease covid19 echina', ' china cdc weekly 2020', '9', ' rothe c schunk m sothmann p bretzel g froeschl gwallrauch c et al', ' transmission of 2019ncov infection froman asymptomatic contact in germany', ' n engl j med 2020 jan30', ' httpsdoi', 'org10', '1056nejmc2001468', '10', ' yu p zhu j zhang z han y huang l', ' a familial cluster ofinfection associated with the 2019 novel coronavirus indicatingpotential persontoperson transmission during the incubationperiod', ' j infect dis 2020 feb 18', ' httpsdoi', 'org10', '1093infdisjiaa077', ' pii jiaa077', 'coronavirus 2 sarscov2 facts and myths11', ' guan wj ni zy hu y laing wh ou cq he jx et al', ' clinicalcharacteristics of 2019 novel coronavirus infection in china', 'medrxiv2020feb9', 'httpsdoi', 'org10', '11012020', '02', '06', '20020974', ' preprint', '12', ' chen n zhou m dong x qu j gong f han y et al', ' epidemiological and clinical characteristics of 99 cases of 2019 novelcoronavirus pneumonia in wuhan china a descriptive study', 'lancet 2020395507e13', ' httpsdoi', 'org10', '1016s0140673620302117', '13', ' huang c wang y li x ren l zhao j hu y et al', ' clinicalfeatures of patients infected with 2019 novel coronavirus inwuhanchina', 'lancet2020395497e506', 'httpsdoi', 'org10', '1016s0140673620301835', '14', ' wang d hu b hu c zhu f liu x zhang j et al', ' clinicalcharacteristics of 138 hospitalized patients with 2019 novelcoronavirusinfected pneumonia in wuhan china', ' j am medassoc 2020 feb 7', ' httpsdoi', 'org10', '1001jama', '2020', '1585', '15', ' yang y lu q liu m wang y zhang a jalali n et al', ' epidemiological and clinical features of the 2019 novel coronavirusoutbreak in china', ' medrxiv 2020 feb 11', ' httpsdoi', 'org10', '11012020', '02', '10', '20021675', '16', ' ryu s chun bc', ' an interim review of the epidemiologicalcharacteristics of 2019 novel coronavirus', ' epidemiol health202042e2020006', '17', ' nishiura h linton nm akhmetzhanov ar', ' initial cluster ofnovel coronavirus 2019ncov infections in wuhan china isconsistent with substantial humantohuman transmission', ' jclin med 20209e488', ' httpsdoi', 'org10', '3390jcm9020488', '18', ' chen h guo j wang c luo f yu x zhang w et al', ' clinicalcharacteristics and intrauterine vertical transmission potentialof covid19 infection in nine pregnant women a retrospectivereview of medical records', ' lancet 2020 feb 12', ' httpsdoi', 'org10', '1016s0140673620303603', '19', ' chan jf yuan s kok kh to kk chu h yang j et al', ' a familialcluster of pneumonia associated with the 2019 novel coronavirus indicating persontoperson transmission a study of afamilycluster', 'lancet2020395514e23', 'httpsdoi', 'org10', '1016s0140673620301549', '20', ' li q guan x wu p wang x zhou l tong y et al', ' earlytransmission dynamics in wuhan china of novel coronavirusinfected pneumonia', ' n engl j med 2020 jan 29', ' httpsdoi', 'org10', '1056nejmoa2001316', '21', ' backer ja klinkenberg d wallinga j', ' incubation period of 2019novel coronavirus 2019ncov infections among travellersfrom wuhan china 2028 january 2020', ' euro surveill 2020255', ' httpsdoi', 'org10', '280715607917', '22', ' chang xu h rebaza a sharma l dela cruz cs', ' protectinghealthcare workers from subclinical coronavirus infection', 'lancet respir med 2020 feb 13', ' httpsdoi', 'org10', '1016s2213260020300667', ' pii s22132600203006630067', '23', ' liu j liu y xiang p pu l xiong h li c et al', ' neutrophiltolymphocyte ratio predicts severe illness patients with 2019novel coronaviruse in the early stage', ' medrxiv 2020 feb 12', 'httpsdoi', 'org10', '11012020', '02', '10', '20021584', '24', ' chung m bernheim a mei x zhang n huang m zeng x et al', 'ct imaging features of 2019 novel coronavirus 2019ncov', 'radiology2020feb4200230', 'httpsdoi', 'org10', '1148radiol', '2020200230', '25', ' lei j li j li x qi x', ' ct imaging of the 2019 novel coronavirus2019ncov pneumonia', ' radiology 2020 jan 31200236', ' httpsdoi', 'org10', '1148radiol', '2020200236', '26', ' pan y guan h', ' imaging changes in patients with 2019ncov', ' eurradiol 2020 feb 6', ' httpsdoi', 'org10', '1007s0033002006713z', '27', ' kanne jp', ' chest ct findings in 2019 novel coronavirus 2019ncov infections from wuhan china key points for the radiologist', 'radiology2020feb4200241', 'httpsdoi', 'org10', '1148radiol', '2020200241', '41128', ' pan y guan h zhou s wang y li q zhu t et al', ' initial ctfindings and temporal changes in patients with the novelcoronavirus pneumonia 2019ncov a study of 63 patients inwuhan china', ' eur radiol 2020 feb 13', ' httpsdoi', 'org10', '1007s0033002006731x', '29', ' duan yn qin j', ' pre and posttreatment chest ct findings 2019novel coronavirus 2019ncov pneumonia', ' radiology 2020 feb12200323', ' httpsdoi', 'org10', '1148radiol', '2020200323', '30', ' lu h', ' drug treatment options for the 2019new coronavirus2019ncov', ' biosci trends 2020 jan 28', ' httpsdoi', 'org10', '5582bst', '2020', '01020', '31', ' wang m cao r zhang l yang x liu j xu m et al', ' remdesivirand chloroquine effectively inhibit the recently emerged novelcoronavirus 2019ncov in vitro', ' cell res 2020 feb 4', ' httpsdoi', 'org10', '1038s4142202002820', '32', ' liu w morse js lalonde t xu s', ' learning from the past possibleurgent prevention and treatment options for severe acute respiratory infections caused by 2019ncov', ' chembiochem 2020 feb 4', 'httpsdoi', 'org10', '1038s4142202002820', '33', ' holshue ml debolt c lindquist s lofy kh wiesman jbruce h et al', ' first case of 2019 novel coronavirus in theunited states', ' n engl j med 2020 jan 31', ' httpsdoi', 'org10', '1056nejmoa2001191', '34', ' ko wc rolain jm lee ny chen pl huang ct lee pi et al', 'arguments in favor of remdesivir for treating sarscov2 infections', ' int j antimicrob agents 2020 mar 6', ' httpsdoi', 'org10', '1016j', 'ijantimicag', '2020', '105933', '35', ' colson p rolain jm raoult d', ' chloroquine for the 2019 novelcoronavirus', ' int j antimicrob agents 2020 feb 17', ' httpsdoi', 'org10', '1016j', 'ijantimicag', '2020', '105923', '36', ' multicenter collaboration group of department of science andtechnology of guangdong province and health commission ofguangdong province for chloroquine in the treatment of novelcoronavirus pneumonia', ' expert consensus on chloroquinephosphate for the treatment of novel coronavirus pneumonia', 'zhonghua jie he he hu xi za zhi 2020 feb 20430e019', 'httpsdoi', 'org10', '3760cma', 'j', 'issn', '10010939', '2020', '0019', 'th e batta g et al', ' cs z kelemen v le thai s csavas m ro37', ' szustructureactivity relationship studies of lipophilic teicoplaninpseudoaglycon derivatives as new antiinfluenza virus agents', 'eur j med chem 20181571017e30', '38', ' zhou n pan t zhang j li q zhang x bai c et al', ' glycopeptide antibiotics potently inhibit cathepsin l in the lateendosomelysosome and block the entry of ebola virus middleeast respiratory syndrome coronavirus merscov and severeacute respiratory syndrome coronavirus sarscov', ' j biolchem 20162919218e32', '39', ' balzarini j keyaerts e vijgen l egberink h de clercq e vanranst m et al', ' inhibition of feline fipv and human sarscoronavirus by semisynthetic derivatives of glycopeptide antibiotics', ' antivir res 20067220e33', '40', ' arabi ym mandourah y alhameed f sindi aa almekhlafi gahussein ma et al', ' corticosteroid therapy for critically ill patients with middle east respiratory syndrome', ' am j respir critcare med 2018197757e67', '41', ' lee n allen chan kc hui ds ng ek wu a chiu rw et al', 'effects of early corticosteroid treatment on plasma sarsassociated coronavirus rna concentrations in adult patients', 'j clin virol 200431304e9', '42', ' lee dt wing yk leung hc sung jj ng yk yiu gc et al', 'factors associated with psychosis among patients with severeacute respiratory syndrome a casecontrol study', ' clin infectdis 2004391247e9', '43', ' xiao jz ma l gao j yang zj xing xy zhao hc et al', ' glucocorticoidinduced diabetes in severe acute respiratory syndromethe impact of high dosage and duration of methylprednisolonetherapy', ' zhonghua nei ke za zhi 200443179e82', '41244', ' russell cd millar je baillie jk', ' clinical evidence does notsupport corticosteroid treatment for 2019ncov lung injury', 'lancet 2020395473e5', '45', ' li g fan y lai y han t li z zhou p et al', ' coronavirus infections and immune responses', ' j med virol 202092424e32', 'httpsdoi', 'org10', '1002jmv', '25685', '46', ' guo l wei d zhang x wu y li q zhou m et al', ' clinicalfeatures predicting mortality risk in patients with viral pneumonia the mulbsta score', ' front microbiol 2019102752', 'httpsdoi', 'org10', '3389fmicb', '2019', '02752', '47', ' patel a jernigan db', ' 2019ncov cdc response team', ' initialpublic health response and interim clinical guidance for the2019 novel coronavirus outbreak e united states decemberc', 'c', ' lai et al', '31 2019february 4 2020', ' mmwr e morb mortal wkly rep202069140e6', '48', ' yen my schwartz j wu js hsueh pr', ' controlling middleeast respiratory syndrome lessons learned from severeacute respiratory syndrome', ' clin infect dis 2015611761e2', '49', ' lee pi hu yl chen py huang yc hsueh pr', ' are children lesssusceptible to covid19 j microbiol immunol infect 2020 feb25', ' httpsdoi', 'org10', '1016j', 'jmii', '2020', '02', '011', '50', ' zou l ruan f huang m liang l huang h hong z et al', ' sarscov2 viral load in upper respiratory specimens of infectedpatients', ' n engl j med 2020 feb 19', ' httpsdoi', 'org10', '1056nejmc2001737', '', ''], 'Covid-19 Pathogenesis, Cytokine Storm And Cytokine Growth Factor Reviews': ['cytokine and growth factor reviews 53 2020 6670contents lists available at sciencedirectcytokine and growth factor reviewsjournal homepage www', 'elsevier', 'comlocatecytogfrcovid19 pathogenesis cytokine storm and therapeutic potential of interferonskeywordsinterferonsrecombinantcoronaviruscovid19sarscov2', 'the outbreak of the novel sarscov2 severe acute respiratory syndrome coronavirus 2 responsible for coronavirus disease 2019 covid19 has developed into an unprecedented global pandemic', ' clinical investigations in patients with covid19 has shown a strong upregulation of cytokine and interferon production in sarscov2 induced pneumonia with an associated cytokine storm syndrome', ' thus the identification of existingapproved therapies with proven safety profiles to treat hyperinflammation is a critical unmet need in order toreduce covi19 associated mortality', ' to date no specific therapeutic drugs or vaccines are available to treatcovid19 patients', ' this review evaluates several options that have been proposed to control sarscov2 hyperinflammation and cytokine storm eincluding antiviral drugs vaccines smallmolecules monoclonal antibodies oligonucleotides peptides and interferons ifns', '', '', '', '1', ' covid19 pathogenesiscovid19 caused by the sarscov2 virus is a potentially fataldisease that represents a major global public health concern', ' the sarscov2 virus infects the lower respiratory tract and causes pneumonia inhumans with symptoms that appear milder than sars or mers infection but ultimately becomes a lethal disease of hyperinflammationand respiratory dysfunction 1', ' bysarscov2 infection and diseasecan be approximately divided into three phases i', ' an asymptomaticphase with or without detectable virus ii', ' a nonsevere symptomaticphase with upper airway involvement and iii', ' a severe potentiallylethal disease with hypoxia ground glass infiltrates in the lung andprogression to acute respiratory distress syndrome ards with highviral load fig', ' 1 2', 'the coronavirus genome encodes four major proteins spike snucleocapsid n membrane m and envelope e', ' the s protein isresponsible for viral entry into target aceii expressing cells of the body', 'approximately 75 percent of the sarscov2 genome is identical to thesarscov genome and the amino acid residues required for receptorbinding are the same between these two viruses both viruses use theangiotensin converting enzyme 2 ace2 receptor to infect airwayepithelial cells and endothelial cells', ' 3', 'ards is the main cause of death in covid19 disease and appearsto cause similar immunopathogenic features in sarscov and merscov infections 4', ' one of the main features of ards is the cytokinestorm  an uncontrolled systemic inflammatory response resulting fromthe release of proinflammatory cytokines and chemokines by immuneeffector cells 5', ' high blood levels of cytokines and chemokines havebeen detected in patients with covid19 infection including il1βil1ra il7 il8 il9 il10 basic fgf2 gcsf gmcsf ifnγ ip10mcp1 mip1α mip1β pdgfb tnfα and vegfa 6', ' the ensuingcytokine storm triggers a violent inflammatory immune response thatcontributes to ards multiple organ failure and finally death in severecases of sarscov2 infection similar to sarscov and merscovinfections 5', ' patients infected with covid19 showed higher leukocyte numbers abnormal respiratory findings and increased levels ofplasma proinflammatory cytokines 4 fig', ' 2 7', ' the direct cause ofdeath from acute covid19 involves cytokine storm damage to lungsand multiple organs of the body heart kidney and liver leading tomultiple organexhaustion 891112', '2', ' interferons as a potential therapy for covid19new therapeutic interventions will likely require a long lead timefor the development of approved drugs', ' thus in light of the dire needand urgency to identify the treatment and control of covid2019 arepurposing of ifns and other approved drugs is a potential option indrug development for the control of coronavirus infection', ' the potential drug options for sarscov2 infection include the use of enzymeinhibitors nucleosides hosttargeted agents convalescent plasma andifns 1314', ' interferons ifn enhance the immune system in severalways by exhibiting various biological functions including antiviralantiproliferative immunomodulatory and developmental activities15 fig', ' 3', ' ifns employed therapeutically are manufactured usingrecombinant dna technology and multiple clinically approved ifns areavailable ifn α2a roferon ifn α2b intron a ifn αn1 wellferon ifn αn3 alferon ifn α con 1 infergen ifn β1a rebififn β1b betaferon ifn β 1a avonex ifn β 1b betaseron ifn α2a pegasys ifn α 2b pegintron ifn α p2b sylatron and ifn γ1b acimmune 1819', 'in a recent study with merscov infected patients the combinationof remdesivir and ifnbeta revealed superior antiviral activity compared to the effect of lopinavir and ritonavir 20', ' treatment of thesepatients with oral ribavirin and subcutaneous pegylated ifn alpha2ademonstrated significant improvement in survival provided that adequate monitoring and assessment was available 2122', ' remdesivirand ifn beta may likewise prove useful in the treatment of covid191416 particularly since recent clinical trials have demonstrated thatremdesivir shortened the length of time in hospital intensive care forcovid19 patients', 'earlier studies showed that coronaviruses including mers sarshuman coronavirus 229e and avian infectious bronchitis virus ibvcytokine and growth factor reviews 53 2020 6670were susceptible to ifn treatment 1723', ' in patients with mers infection a combination of ritonavir plus ifn α2a or ifn α2b resulted insignificantly improved survival after 14 days of treatment', ' the combination of ritonavir and ifnβhad no significant effect on clinical outcome in patients infected with mers but the combination of ribavirin1 ritonavir 2 and ifn α2a inhibited viremia within 48h of treatment 13', ' the use of recombinant ifns ifn α ifn β and exogenousifns in the treatment of sarscov2 sarscov and merscov demonstrated that ifn response inhibited protein synthesis and replication of the virus 2426', ' ifn α and γ alone or in combination showedpartial efficacy against the animal coronaviruses as well as inhibitingsarscov replication in vitro', ' ifn β had the highest potencydemonstrating prophylactic protection and antiviral potential post infection 27', ' therefore it may be worthwhile to test the safety andefficacy of human and recombinant ifns in sarscov2infected patients alone or in combination with other antiviral drugs', '3', ' potential combination approaches for covid19at present there are no food and drug administration fdaapproved drugs specifically indicated for the treatment of patients withcovid19 with the exception of the recently studied remdesivir', ' it wasshown that remdesivir reduced the patients time in icu from fifteendays to eleven days', ' originally developed as a small molecule67cytokine and growth factor reviews 53 2020 6670fig', ' 3', ' mechanism of interferon biosynthesis and their functions', '', '', '', '1 y', ' chen q', ' liu d', ' guo emerging coronaviruses genome structure replication andpathogenesis j', ' med', ' virol', ' 92 2020 418423 httpsdoi', 'org10', '1002jmv', '25681', '2 y', ' shi y', ' wang c', ' shao et al', ' covid19 infection the perspectives on immuneresponses cell death differ', ' 27 2020 14511454 httpsdoi', 'org10', '1038s4141802005303', '3 h', ' li s', 'm', ' liu x', 'h', ' yu c', 'l', ' tang c', 'k', ' tang coronavirus disease 2019 covid19 current status and future perspectives int', ' j', ' antimicrobial agents 2020105951 httpsdoi', 'org10', '1016j', 'ijantimicag', '2020', '105951', '4 c', ' huang y', ' wang x', ' li l', ' ren j', ' zhao y', ' hu et al', ' clinical features of patientsinfected with 2019 novel coronavirus in wuhan china lancet 395 10223 2020497506 httpsdoi', 'org10', '1016s0140673620301835', '5 x', ' li m', ' geng y', ' peng l', ' meng s', ' lu molecular immune pathogenesis and diagnosis of covid19 j', ' pharm', ' analysis 2020 httpsdoi', 'org10', '1016j', 'jpha', '2020', '03', '001', '6 h', 'a', ' rothan n', ' siddappa s', 'n', ' byrareddy the epidemiology and pathogenesis ofcoronavirus disease covid19 outbreak j', ' autoimmun', ' 109 2020 102433 httpsdoi', 'org10', '1016j', 'jaut', '2020', '102433', '7 x', ' sun t', ' wang d', ' cai z', ' hu j', ' chen h', ' liao l', ' zhi h', ' wei z', ' zhang y', ' qiuj', ' wang a', ' wang cytokine storm intervention in the early stages of covid19pneumonia cytokine growth factor rev', ' 2020 httpsdoi', 'org10', '1016j', 'cytogfr', '2020', '04', '002', '8 p', ' mehta d', 'f', ' mcauley m', ' brown e', ' sanchez r', 's', ' tattersall j', 'j', ' manson covid19 consider cytokine storm syndromes and immunosuppression lancet 2020httpsdoi', 'org10', '1016s0140673620306280', '9 j', 'r', ' tisoncik m', 'j', ' korth c', 'p', ' simmons j', ' farrar t', 'r', ' martin m', 'g', ' katze into theeye of the cytokine storm microbiol', ' mol', ' biol', ' rev', ' 76 2012 1632 httpsdoi', 'org10', '1128mmbr', '0501511', '10 b', ' liu m', ' li z', ' zhou x', ' guan y', ' xiang can we use interleukin6 il6 blockadefor coronavirus disease 2019 covid19induced cytokine release syndromecrs j', ' autoimmun', ' 2020 httpsdoi', 'org10', '1016j', 'jaut', '2020', '102452102452', '11 y', ' wang x', ' chen w', ' cao y', ' shi plasticity of mesenchymal stem cells in immunomodulation pathological and therapeutic implications nat', ' immunol', ' 152014 10091016 httpsdoi', 'org10', '1038ni', '3002', '12 g', ' wang k', ' cao k', ' liu y', ' xue a', 'i', ' roberts f', ' li et al', ' kynurenic acid an idometabolite controls tsg6mediated immunosuppression of human mesenchymalstem cells cell death differ', ' 25 2018 12091223 httpsdoi', 'org10', '1038s4141801700062', '13 g', ' li e', ' de clercq therapeutic options for the 2019 novel coronavirus 2019ncov nat', ' rev', ' drug discov', ' 19 2020 149150 httpsdoi', 'org10', '1038d41573020000160', '14 t', ' pillaiyar s', ' meenakshisundaram m', ' manickam recent discovery and development of inhibitors targeting coronaviruses drug discov', ' today 2020 httpsdoi', 'org10', '1016j', 'drudis', '2020', '01', '015', '15 b', 'x', ' wang e', 'n', ' fish global virus outbreaks interferons as 1st responders semin', 'immunol', ' 43 2019 101300  httpsdoi', 'org10', '1016j', 'smim', '2019', '101300', '16 e', ' kindler v', ' thiel f', ' weber interaction of sars and mers coronaviruses withthe antiviral interferon response adv', ' virus res', ' 96 2016 219243', '17 y', ' yin r', 'g', ' wunderink mers sars and other coronaviruses as causes of pneumonia respirology 23 2018 130137 httpsdoi', 'org10', '1111resp', '13196', '18 e', 'l', ' tan e', 'e', ' ooi c', 'y', ' lin h', 'c', ' tan a', 'e', 'b', ' ling l', 'w', ' stanton inhibition of sarscoronavirus infection in vitro with clinically approved antiviral drugs emerg', 'infect', ' dis', ' 10 4 2004 581586', '19 n', ' uppangala recombinant interferon as drugs httpswww', 'biotecharticles', 'comhealthcarearticlerecombinantinterferonasdrugs196', 'html', '20 t', 'p', ' sheahan a', 'c', ' sims s', 'r', ' leist a', ' schafer j', ' won et al', ' comparative therapeutic efficacy of remdesivir and combination lopinavir ritonavir and interferonbeta against merscov nat', ' commun', ' 11 2020 222', '21 a', 's', ' omrani m', 'm', ' saad k', 'baig a', ' bahloul m', ' abdulmatin a', 'y', ' alaidaroosg', 'a', ' almakhlafi m', 'm', ' albarrak z', 'a', ' memish a', 'm', ' albarrak ribavirin and interferon alfa2a for severe middle east respiratory syndrome coronavirus infectiona retrospective cohort study lancet infect', ' dis', ' 14 2014 10901095', '22 l', ' bouadma f', 'x', ' lescure j', 'c', ' lucet y', ' yazdanpanah j', 'f', ' timsit severe sarscov2 infections practical considerations and management strategy for intensivistsintensive care med', ' 46 2020 579582', '23 l', 'e', ' hensley l', 'e', ' fritz p', 'b', ' jahrling c', 'l', ' karp j', 'w', ' huggins t', 'w', ' geisbertinterferonbeta 1a and sars coronavirus replication emerg', ' infect', ' dis', ' 10 22004 317319', '24 d', ' falzarano e', ' wit a', 'l', ' rasmussen f', ' feldmann h', ' feldmann treatment withinterferonα2b and ribavirin improves outcome in merscovinfected rhesus macaques nat', ' med', ' 19 10 2013 13131317', '25 c', 'c', ' li x', 'j', ' wang h', 'r', ' wang repurposing hostbased therapeutics to controldr', ' shivraj nile obtained m', 'sc', ' in biotechnology 2004and phd in life science srtm university india 2010', ' heworked as kubrain pool postdoctoral fellow 20122014konkuk university he currently working as associateprofessor zhejiang chinese medical university china', 'previously worked as assistant professor konkukuniversity korea 20142018 and srtm universitynanded 20102014', ' received rgnf research fellowshipugc india 20062010', ' he had 9 years research experience in food science phytochemistry biotechnologyand nanotechnology', ' dr', ' nile had more than 85 researchpublications including crit', ' rev', ' food sci nutr trends infood sci technol nanomicro lett j', ' clean prod foodchem food chem toxicol ind crops products nutrition food res int food functionphytomedicine frontiers in pharmacology and food review int', ' also having 3 patentsand 6 research projects on his credit and he received 12 national and international research awards', ' associate editor for efood journal combinatorial chemistry  highthroughput screening journal recent patents on food nutrition  agriculture currentpharmaceutical analysis journal of nutrition  health journal of analytical molecular techniques international journal of recent trends in science  technologyand journal of environmental studies', ' his expertise is food science biochemistrypharmacology natural products nanotechnology and drug discovery', ' his researchmainly focused on functional food natural colorants drug development food nanotechnology and phytomedicine', 'ms', ' arti nile finished her masters degree in biotechnology2012 srtm university india', ' she is having 3 years industrial experience as cra and cdm', ' currently she is perusing her phd in food science konkuk university korea', 'her major research focused on utilization of fruit and cropwaste towards bioactive compound extraction and determination of biological activities', ' she got research fellowship from nrfkorea for her phd work and she published more than 10 research papers in variousinternational journals', ' she is also having good experiencewith clinical research and data management', '69cytokine and growth factor reviews 53 2020 6670dr', ' jiayin qiu obtained her phd in pharmacologysouthern medical university china 2014', ' she worked asa visiting student in weizman institute of science in isreal20122014', ' she currently working as postdoctoral inzhejiang chinese medical university china', ' host youthprogram of national natural science foundation of china20162018 and natural science foundation of guangdongprovince 20152017', ' dr', ' qiu had 19 research publicationsincluding j biol chem frontiers in pharmacology andjournal of antimicrobial chemotherapy etc', ' her researchmainly focused on antivirus pharmacolo gy', 'published in the journal cell', ' his expertise is on antibiotic resistance the structure andfunction of noncoding rnas especially riboswitch sarscov2 covid19 antivirusdrugs bacterial epidemiology antibacterial drugs and aging', 'prof', ' guoyin kai obtained his phd in biochemistry andmolecular biology shanghai jiaotong university china2005', ' he worked as a visiting scholar in brookhavennational laboratory in usa 20122013', ' he currentlyworking as professor zhejiang chinese medical universitychina', ' previously worked as associate professor 20052012 and professor 20122017 in shanghai normaluniversity china 20052017', ' received excellent youthtalent project from national science fund 20162018 andmeiji life science award china 2014', ' prof', ' dr', ' kai hadmore than 100 research publications including metab engchem eng j new phytol nanomicro lett crit', ' rev', ' foodsci nutr j exp bot food chem nanomedicinephytomedicine j', ' agr food chem food chem toxicol and pnas etc', ' also having 17chinese patents and 28 research projects as pi and received 14 research awards', ' hisexpertise is on biotechnology and bioactive compounds and their biological evaluation', 'his research mainly focused on natural product phytomedicine and biotechnologyprof', ' lin li is a professor of pharmacology of school ofpharmaceutical sciences southern medical university', ' shewas awarded with the outstanding teacher of southernmedical university', ' prof', ' li obtained her phd inpharmacology southern medical university china 2010', 'in 2012 prof', ' li was trained by david geffen school ofmedicine in university of california for teaching skills', 'during 2008 to 2010 she worked as a visiting scientist innew york blood center', ' prof', ' li is the director of worldfederation of chinese medicine societies the secretarygeneral of division of antiinflammatory and immunologyof chinese pharmacological society cps', ' prof', ' li mainlyengaged in antiviral drug development and hiv latencyresearch', ' she was awarded about seven research grants', ' prof', ' li has already publishedmore than 30 sci papers in academic journals like j antimicrob chemother j', ' acquir', 'immune defic', ' syndr', ' retrovirology antimicrob', ' agents chemother with a total impactfactor over 100', 'shivraj hariram nilea arti nilea jiayin qiua lin lib xu jiacguoyin kaiaadepartment of pharmacy zhejiang chinese medical university hangzhouzhejiang 310053 chinabguangdong provincial key laboratory of new drug screening guangzhoukey laboratory of drug research for emerging virus prevention andtreatment school of pharmaceutical sciences southern medical universityguangzhou chinacnoncoding rna and drug discovery key laboratory of sichuan provincechengdu medical college chengdu 610500 chinaemail addresses jiaxucmc', 'edu', 'cn x', ' jiaguoyinkai1126', 'com g', ' kai', 'prof', ' xu jia obtained his phd in biochemistry andmolecular biology fu dan university china 2012', ' heworked as a professor in chengdu medical college since2012', ' received national natural science foundation ofchina 2013 2014 2018 and sichuan science and technology fund for outstanding youth 2014', ' he became thehead of the research and innovation team of universities insichuan province for research on bacterial resistance andantiinfection 2015', ' honors he received outstandingcontribution of sichuan provincial commission of healthand family planning 2017 sichuan thousand talentsprogram 2018 sichuan academic and technologicalleader 2018 sichuan new youth 2019', ' prof', ' dr', ' jia hadmore than 20 research publications including cell nucleic acids research and frontiersin microbiology etc', ' the related results on the mechanism of bacterial resistance were', ''], 'Deamidation In Moxetumomab Pasudotox Leading To Conformational Change And Immunotoxin Activity Loss': ['journal of pharmaceutical sciences 109 2020 26762683contents lists available at sciencedirectjournal of pharmaceutical sciencesjournal homepage www', 'jpharmsci', 'orgdrug discoverydevelopment interfacedeamidation in moxetumomab pasudotox leading toconformational change and immunotoxin activity lossxiaojun lu shihua lin niluka de mel arun parupudi jared delmar madhu pandeyxiangyang wang jihong wanganalytical sciences biopharmaceutical development astrazeneca one medimmune way gaithersburg maryland 20878article info', 'article historyreceived 16 february 2020revised 14 may 2020accepted 1 june 2020available online 11 june 2020asparagine asn deamidation is a common posttranslational modiﬁcation in which asn is converted toaspartic acid or isoaspartic acid', ' by introducing a negative charge deamidation could potentially impactthe binding interface and biological activities of protein therapeutics', ' we identiﬁed a deamidationvariant in moxetumomab pasudotox an immunotoxin fv fusion protein drug derived from a 38kdatruncated pseudomonas exotoxin a pe38 for the treatment of hairycell leukemia', ' although the deamidation site asn358 was outside of the binding interface the modiﬁcation had a signiﬁcant impact onthe biological activity of moxetumomab pasudotox', ' surprisingly the variant eluted earlier than its unmodiﬁed form on anion exchange chromatography which often leads to the conclusion that it has ahigher positive charge', ' here we describe the characterization of the deamidation variant with differentialscanning calorimetry and hydrogendeuterium exchange mass spectrometry which revealed that theasn358 deamidation caused the conformational changes in the catalytic domain of the pe38 region', 'these results provide an explanation for why the deamidation affected the biological activity of moxetumomab pasudotox and suggest the approach that can be used for process control to ensure productquality and process consistency', ' 2020 the authors', ' published by elsevier inc', ' on behalf of the american pharmacists association', ' thisis an open access article under the cc byncnd license httpcreativecommons', 'orglicensesbyncnd4', '0', 'keywordsproteins structureprotein conformationprotein stabilityprotein foldingposttranslational modiﬁcationmass spectrometrycalorimetrymodelingdeamidationbiological activityhydrogendeuterium exchange', '', 'since the approval of recombinant human insulin by the u', 's', 'food and drug administration fda in 1982 the use of therapeuticproteins for the treatment of many diseases and disordersincluding cancer autoimmune and inﬂammatory disorders andmetabolic cardiovascular and infectious diseases has growntremendously', '12 proteinbased biopharmaceuticals often havehigher speciﬁcity and therefore lower potential to cause adverseeffects and immune responses than smallmolecule drugs but theyalso present their own challenges', '2 one of the most critical of thesecurrent address for lu adimab 7 lucent drive lebanon nh 03766 usa', 'current address for x', ' wang and j', ' wang viela bio one medimmune way gaithersburg md 20878 usa', 'disclosure of potential conﬂicts of interest this study was funded by astrazenecaunited kingdom', ' all authors are or were employees of astrazeneca at the time thiswork was performed with stock interests or options in astrazeneca', ' corresponding author', 'email address wangjhvielabio', 'com j', ' wang', 'challenges is the chemical degradation that may occur during themanufacturing and storage of most therapeutic proteins whichleads to one or more posttranslational modiﬁcations ptms', '23asparagine asn deamidation one of most common nonenzymatic ptms has long been considered to be a major degradationpathway for many monoclonal antibodies and other therapeuticproteins', '4 it is generally believed that under neutral and basicconditions the reaction goes through a ﬁvemembered cyclic succinimide intermediate which then hydrolyzes and yields bothisoaspartic acid and aspartic acid asp', '57it has been reported that asn deamidation could have a significant impact on the biological activity of therapeutic proteins', ' forexample in a study of dornase alpha a recombinant enzyme usedfor the treatment of cystic ﬁbrosis deamidation of a single asnresidue resulted in loss of its biological activity', '8 deamidation wasalso reported to compromise antibody colloidal stability and toincrease aggregation under lowph conditions', '9 especially in lightof the relationship between protein structure and function detailedstructural characterization is essential to understand the molecularbasis of such reactions', 'httpsdoi', 'org10', '1016j', 'xphs', '2020', '06', '00200223549 2020 the authors', ' published by elsevier inc', ' on behalf of the american pharmacists association', ' this is an open access article under the cc byncnd licensehttpcreativecommons', 'orglicensesbyncnd4', '0', 'x', ' lu et al', '  journal of pharmaceutical sciences 109 2020 26762683hydrogendeuterium exchange hdx mass spectrometry mshas emerged as a useful tool to monitor the conformation anddynamics of therapeutic proteins', '1013 conventional biophysicaltechniques such as circular dichroism and ﬂuorescence1416 provideonly general information and it is difﬁcult to detect subtleconformational changes or changes related only to speciﬁc regionsof proteins with these techniques', ' in contrast hdxms can be usedto detect and localize the impact of ptms on the structure of proteins at the peptide level or even at the residue level', ' for examplehdx has been used to study asp isomerization and methionineoxidation in complementaritydetermining regions cdrs of antibodies', ' although they are only one amino acid apart in sequencethese two modiﬁcations have been found to result in opposingconformational impacts on local and nearby regions leadingdirectly to different alterations on antibodyantigen binding afﬁnity', '17 it has also been reported that oxidation of a cdr tryptophanresidue signiﬁcantly reduces antigen binding afﬁnity and hdxmsdata have revealed that the modiﬁcations increase the ﬂexibility ofvariable regions and disrupt local conformation', '18 although asimilar experiment with asn deamidation revealed no measurablelocal conformational changes caused by the modiﬁcation thisﬁnding may have been compromised by the low deamidation levels30 in the material used in the study', '19a few studies have explored how asn deamidation affects thethreedimensional structure of proteins', '2025 deamidation of human norovirus capsid protein has been reported to attenuate glycanbinding and hdxms data have revealed localized alterations inprotein ﬂexibility supporting ﬁndings from nuclear magneticresonance and xray crystallography studies', '26 in another hdxmsstudy deamidation was reported to slow curli amyloidproteinaggregation', '11moxetumomab pasudotox formerly cat8015 is a recombinant immunotoxin therapeutic protein developed for the treatmentof bcell malignancies27 that received fda approval in september2018 for the treatment of adults with relapsed or refractory hairycell leukemia who have received at least two prior systemic therapies including treatment with a purine nucleoside analog', '2829 it iscomposed of a 38kda truncated pseudomonas exotoxin a pe38that is genetically fused to the variable fragment fv of an anticd22 antibody', ' when bound to cd22 a blymphocyteespeciﬁccell surface protein it is rapidly internalized and processed', ' thepseudomonas exotoxin pe catalyzes the transfer of adp ribosefrom nicotinamide adenine dinucleotide nad to eukaryoticelongation factor 2 eef2 which inhibits protein translation andleads to cell death', ' deamidation in the catalytic domain of pe38 atasn358 has previously demonstrated signiﬁcantly reduced biological activity in cellbased bioassay30 but it remains unclear howa single residue modiﬁcation could have such a marked impact onthe cytotoxicity of the molecule', ' another puzzling observation isthat the deamidated species eluted before the major product peakon a positively charged anion exchange column despite the factthat asn deamidation introduces an extra negative charge', 'in this work asn358edeamidated moxetumomab pasudotoxwas ﬁrst isolated using ion exchange chromatography iec', ' thestructural impact of deamidation was carefully examined by bothdifferential scanning calorimetry dsc and hdxms whichshowed alteration of the conformation of the pe catalytic domain', 'in the comprehensive functional studies described here we gaineda deep understanding of why the single deamidation diminishedbiological activity and appeared as a basic variant an early elutionpeak in anion exchange chromatography', ' after evaluation of theresults from our stability study and the refolding process a controlstrategy was established and implemented in the commercialmanufacture process to minimize the deamidation level and tomaintain process and product consistency', '2677fig', ' 1', ' iec fractionation of moxetumomab pasudotox', ' iec proﬁles of a starting material b prepeak fraction and c main peak fraction', 'materials and methodsmoxetumomab pasudotoxrecombinant moxetumomab pasudotox used in this study wasexpressed in escherichia coli strains and was puriﬁed at astrazenecagaithersburg md as previously described', '31 all other commercialchemicals were reagent grade or better', ' peptide mapping and cellbased bioassay methods were employed as previously described', '30iec fractionationiec fractionation was performed on a 1200 hplc systemequipped with a plsax strong anion exchange column4', '6  50 mm 8 mm 1000 å agilent santa clara ca', ' mobile phasea was composed of 10 mm tris and 1 mm ethylenediaminetetraacetic acid ph 8', '0 and mobile phase b was composed of 10 mmtris 1 mm ethylenediaminetetraacetic acid and 0', '5 m nacl ph 8', '0', 'for each experiment 500 ml of moxetumomab pasudotox startingmaterial at a concentration of 1 mgml was loaded on the systemand eluted with a linear gradient of up to 80 mobile phase b at aﬂow rate of 1', '0 mlmin', ' the eluted protein was monitored by ultraviolet absorbance at 280 nm and two fractions prepeak andmain peak were collected with a fraction collector', ' the fractionsfrom multiple injections were pooled together and bufferexchanged with 25 mm sodium phosphate ph 7', '4 to a ﬁnal2678x', ' lu et al', '  journal of pharmaceutical sciences 109 2020 26762683threedimensional structures of pe38 were drawn based on thestructure 1ikq from the protein data bank', 'cd22 binding assayfig', ' 2', ' dsc thermograms of iec prepeak deamidated product and main peakoriginal protein fractions', ' cp ¼ heat capacity tm ¼ melting temperature', 'concentration of approximately 1 mgml', ' the purity of iec fractionation was veriﬁed by injecting 25 mg of starting material and5 mg of each fraction on the anion exchange column', 'a surface plasmon resonanceebased characterization assay wasused to measure the kinetic binding afﬁnity equilibrium dissociation constant kd of moxetumomab pasudotox for human cd22', 'an antihis tagged antibody was immobilized to two ﬂow cells of asensor chip using a standard amine coupling procedure', ' a reference surface was created by omitting the capture of cd22 on oneﬂow cell', ' a dilution series of moxetumomab pasudotox was prepared and then injected in a serialﬂow fashion across the referencesurface and the cd22 surface followed by regeneration of both ﬂowcells', ' the data were reference ﬂow cell subtracted and bufferblanked and then ﬁt to a 11 binding model using biacore evaluation software precision antibody columbia md', ' this modelyields an association rate constant ka and a dissociation rateconstant kd', ' the kd for the interaction between moxetumomabpasudotox and cd22 was determined by the equation kd ¼ kdka', 'internalization assaydifferential scanning calorimetrydsc experiments were performed with a microcal vpcapillarydsc instrument malvern instruments malvern pa at a concentration of approximately 1 mgml', ' a scan rate of 60  c per hour wasused with temperatures ranging from 20  c to 100  c', ' results wereanalyzed with origin 7', '0 microcal plugin software malvern instruments', ' concentrationnormalized data were ﬁtted to a nonetwostate model with two peaks to calculate melting temperatureand calorimetric enthalpy of the individual domains after subtracting the heat capacity of the reference buffer', 'kinetic imaging analysis was used to determine whether moxetumomab pasudotox iec prepeak material was internalized intoblymphoma cells', ' moxetumomab pasudotox was conjugated withalexa fluor 647 thermo fisher scientiﬁc waltham ma and wasbound to daudi cells', ' the internalization of moxetumomab pasudotox was monitored with confocal ﬂuorescence microscopy', 'quantitative assessment of kinetic images of the cell membraneand cytoplasm over time demonstrated the internalization ofmoxetumomab pasudotox into the cytoplasm', 'adp ribosylation assayhdxms analysishdxms analysis was performed by using waters hdx technology waters milford ma', ' both iec prepeak and main peakfractions were concentrated to 4 mgml prior to the hdx experiment', ' samples containing 2 ml each were diluted 10fold witheither h2o buffer 25 mm sodium phosphate ph 7', '4 or d2o buffer25 mm sodium phosphate ph 7', '4 at 25  c', ' after incubation for0 undeuterated 0', '5 1 5 10 30 60 and 120 min the labeledsamples were quenched by adding 20 ml of icecold quench buffer7', '2 m guanidine 500 mm tris2carboxyethyl phosphine hydrochloride ph 2', '4 and were then further diluted with 120 ml of icecold 0', '1 formic acid solution', ' immediately 50 ml of diluted samples was digested using an enzymate pepsin column 5 mm2', '1  30 mm waters at 20  c', ' the peptic fragments were collectedwith an acquity beh c18 vanguard precolumn 2', '1  5 mmwaters and eluted into an acquity beh c18 column 1', '7 mm1', '0  100 mm waters at 0  c', ' peptides separated on the columnwere analyzed with a xevo g2xs qtof mass spectrometer waters', ' data analysis was performed as previously described23 andan adp ribosylation assay was used to evaluate the adp ribosylation activity of moxetumomab pasudotox in vitro', ' moxetumomab pasudotox reference standard and test samples wereserially diluted in ultrapure nucleasefree water and incubatedwith an adp ribosylation assay system containing eukaryotic eef2nadþ luciferase mrna complete amino acids mixture rnase inhibitor and wheat germ extract in a 96well plate for 2 h at ambienttemperature', ' after incubation an equal volume of steady gloluciferase assay buffer and substrate promega madison wi wasadded to each well and the plate was incubated at ambient temperature with gentle shaking for 30 min before the luminescencewas read on a plate reader', ' the amount of luminescence detected ineach well was directly proportional to the amount of translatedluciferase protein which was inversely proportional to the amountof adp ribosylation of eef2 by moxetumomab pasudotox', ' the testsample would be considered active if inhibition of luciferase mrnatranslation was similar to that in the moxetumomab pasudotoxreference standard', ' if there was no inhibition of luciferase mrnatranslation the sample would be inactive', 'table 1dsc melting temperature and enthalpy of the prepeak deamidated product and main peak original protein fractions', 'samplex', ' lu et al', '  journal of pharmaceutical sciences 109 2020 26762683results and discussionseparation and identiﬁcation of asn358 deamidated variantiec analysis of moxetumomab pasudotox starting material led toa twopeak proﬁle indicating the presence of two charge variantsfig', ' 1a', ' the elution time of these variants 10', '0 min and 12', '5 minwere consistent with those in previous studies2130 so these two iecpeaks were termed prepeak and main peak', ' successfulenrichment of two variants was conﬁrmed fig', ' 1b and c andsubsequent peptide mapping analysis revealed that the prepeakfraction was mainly asn358 deamidated moxetumomab pasudotox 97', '5 whereas the main peak fraction contained only 9', '6deamidated asn358', ' other deamidation site asn243 showed nosigniﬁcant difference in deamidation levels between the two iecfractions', ' nonreducing peptide mapping results showed the samedisulﬁde bond linkages for both prepeak and main peak', 'dsc studyas a technology that can monitor the thermal unfolding transitions of a protein dsc provided the ﬁrst insight on the structuralimpact of asn358 deamidation', ' dsc measurements of both theprepeak and the main peak fractions showed two distinct transitions the ﬁrst at 44  c and the second at 78  c fig', ' 2 andtable 1', ' native trypsin digestion of moxetumomab pasudotox wasused to assign the ﬁrst peak to unfolding of the pe38 domains andthe second peak to the fv domain see supplementary figs', ' s1 s2s3 and table s1 which is consistent with previous ﬁndings', '32comparison of the two dsc proﬁles revealed that both fractionsshared similar melting transition points for the fv domain but thepe38 domain of the prepeak fraction showed a decrease of 1', '3  c inmelting temperature and a 15kcal loss in enthalpy compared withthe main peak fraction', ' these results suggest that asn358 deamidation had no effect on fv thermal stability but slightly destabilized the pe38 region indicating the possible conformationchange in pe38', 'hdxms analysisto further localize the conformational change caused by asn358deamidation hdxms was employed to analyze the two iec fractions', ' a total of 182 peptic peptides were identiﬁed during the hdxdata processing and the standard deviation for each exchange time2680x', ' lu et al', '  journal of pharmaceutical sciences 109 2020 26762683point was determined to be 0', '3 dalton da', ' among all identiﬁedpeptides 14 were from the variable domain of the light chain lcresulting in 81 of the lc sequence coverage', ' both fractions hadsuperimposable exchange kinetic curves for the peptide lc 37e47fig', ' 3a indicating no conformational difference in this peptideregion', ' similar results were also observed for the other 13 lc peptides', ' to gain a global view of the lc the differences in deuteriumincorporation between the two fractions were calculated for all thelc peptides fig', ' 3b', ' it is clear that all these differences were smallerthan 0', '3 da and were insigniﬁcant so it was concluded that therewas no structural difference between the two iec fractions in the lcwhich is consistent with similar dsc melting temperaturesobserved from the second thermal transition', 'the rest of the 168 peptides were identiﬁed to provide 96sequence coverage of the variable heavy and pe38 domains vhpe38 also referred to as heavy chain hc and their hdxms datawere more complex than those from the lc', ' first consistent withthe lc all peptides located in the fv region residues hc1e129showed no difference between the two fractions exchange kineticcurves of peptides hc52e69 are shown as an example in fig', ' 3a', 'second most peptides in the pe38 region residues hc130e476showed no or only minor differences 0', '3 da in deuterium uptake between the prepeak and the main peak fractions suggestingthat no signiﬁcant conformational difference was caused by asn358 deamidation in most of the pe38 region', ' finally obvious differences were observed for peptides associated with four regionsx', ' lu et al', '  journal of pharmaceutical sciences 109 2020 267626832681plausible mechanism for biological activity losshc270e280 hc301e315 hc334e362 and hc428e455', ' thepeptides in regions hc267e275 hc301e307 hc341e361 andhc428e454 all exhibited higher deuterium uptake in the prepeakfraction than in the main peak fraction fig', ' 3a and all otherpeptides related to these regions showed similar differencesfig', ' 3c', ' the differences at many exchange time points weregreater than 0', '3 da and a few were as high as 2', '5 da', ' these resultsindicated that some local conformational changes led to less protection against deuterium exchange in these regions', 'one limitation of the differences shown in fig', ' 3c is that thepeptide length was not considered', ' longer peptides sometimesshow more signiﬁcant differences than short ones because they canaccumulate more backbone amide deuterium and backexchangecan easily overwhelm the exchange on shorter peptides', ' to takethe peptide length into account the differences in deuterium uptake by pe38 peptides between the two fractions were divided bythe total number of the exchangeable amide hydrogens in eachpeptide depicted as colors in the heat map fig', ' 4', ' this heat mapclearly highlights the four pe38 regions in which the prepeakfraction showed signiﬁcantly higher deuterium uptake than themain peak fraction', ' overall the hdx data suggest that asn358deamidation had no impact on the fv region but did change localconformation in four regions in pe38', ' considering that these regions account for only 24 of the total pe38 sequence these dataare consistent with the 1', '3  c difference in the dsc melting temperature in the ﬁrst transition', 'in addition careful examination of the sequence revealed thatthese hdxdeﬁned regions contained a total of ﬁve arginine residues', ' because the hdx data suggested that these regions gainedmore solvent accessibility due to the deamidation of asn358 thedeamidated moxetumomab pasudotox molecules might exposemore positive charges that overcome one negative charge fromasn358 deamidation', ' this would explain why the deamidatedspecies eluted before the unmodiﬁed ones on a positively chargedanion exchange column', 'as a truncated form of pe pe38 contains part of the expressionimprovement domain domain ib the translocation domaindomain ii and the adp ribosyltransferase enzyme domaindomain iii as shown in supplementary fig', ' s4 sequence alignmentof pe and pe38 domains', ' the ﬁnding that all four hdxdeﬁnedregions were in domain iii suggested that the deamidation ofasn358 asn495 in pe led to the misfolding of the catalyticdomain and reduction of the biological activity of moxetumomabpasudotox', ' in a previous structural study of the complex eef2peeef2 mainly bound to 486e493 576e580 and arg412 of pe', '33when the hdx heat map and these eef2 binding interfaces weresuperimposed on the crystal structure of pe in our study fig', ' 5 itbecame obvious that the eef2 binding interface completely overlapped with the four hdxdeﬁned regions 270e280 301e315334e362 and 428e455 407e417 438e452 471e499 and565e592 in pe see supplementary fig', ' s4 for sequence alignmentof pe and pe38', ' furthermore ﬁve of nine residues that constructedthe nad binding interface were also located in these hdxdeﬁnedregions fig', ' 5b', '34 all of these results suggest that the conformational changes resulting from asn358 deamidation disruptedbinding of moxetumomab pasudotox to eef2 and nad which led toloss of pe38mediated cellkilling biological activity', 'this proposed mechanism is supported by observations fromfurther biological characterization of the iec prepeak fractiontable 2', ' the target binding results indicate that the iec prepeakmaterial is capable of binding to the soluble cd22 with an afﬁnitysimilar to that of the main peak indicating that deamidation ofpe38 at residue asn358 does not have an impact on binding to thecd22', ' kinetic imaging analysis was used to determine whether themoxetumomab pasudotox iec prepeak material was internalizedinto blymphoma cells', ' quantitative assessment of kinetic imagesof the cell membrane and cytoplasm over time demonstrated theinternalization of moxetumomab pasudotox into the cytoplasm', 'x', ' lu et al', '  journal of pharmaceutical sciences 109 2020 26762683the iec prepeak material was internalized into the cells with kinetics similar to those of the moxetumomab pasudotox startingmaterial supplementary fig', ' s5', ' the adp ribosylation activity ofmoxetumomab pasudotox was assessed by using an in vitro luciferase translation assay', ' no inhibition of the luciferase mrnatranslation was observed for iec prepeak material whereas themoxetumomab pasudotox starting material inhibited the luciferasemrna translation in a dosedependent manner fig', ' 6', ' these results suggest that the iec prepeak material had dramaticallydecreased activity to induce the adp ribosylation of eef2 as indicated by the changes on the catalyst domain of pe38 and thereforecaused the loss of cellkilling activity', 'the correlation of iec prepeak levels with relative potency byapoptosis bioassay were linearly plotted as described in a priorstudy30 but the ratio of the percent increase in deamidation to thepercent decrease in relative potency was not 11', ' a spiking studywas therefore carried out in which various ratios of puriﬁed iecprepeak to main peak were tested for relative potency', ' the correlation between iec prepeak to potency was nonlinear fig', ' 7indicating that the iec prepeak material was not only inactive butalso appeared to competitively inhibit the biological activity ofmoxetumomab pasudotox', ' the relationship between the iec prepeak and relative potency can been expressed asy ¼ að1  xþ  ð1  bxþwhere x is percent prepeak y is percent relative potency a is therelative potency of the pure main peak percent prepeak is 0 andb is the factor of competitive inhibition', ' in this case b is approximately 0', '55', ' with an understanding of the correlation betweenprepeak and relative potency an appropriate speciﬁcation can beset for the prepeak to ensure drug efﬁcacy and safety', 'interestingly the asn358 deamidation level did not changeduring the forced degradation study at high ph', ' the crystallinestructure of pe indicates that asn358 asn495 in pe is buried soasn358 deamidation can occur only during the refolding stepwhen the molecule is exposed to high ph and denaturing conditions', ' the deamidated molecule folded incorrectly', ' with a clearunderstanding of the structural impact of the deamidation processcontrol can be achieved by optimizing the refolding conditions andthe puriﬁcation process to consistently produce highqualityproduct', 'conclusionsin this study we report a conformational change caused by asingle asn deamidation based on dsc and hdxms data', ' our resultsprovide an explanation for how asn358 deamidation impacted thebiological activity of moxetumomab pasudotox and why the deamidated variant eluted as an early peak in anion exchange chromatography', ' importantly our results indicate that residue asn358is enveloped once the protein is folded and thus will not changeduring storage conditions', ' with a clear understanding of thestructurefunction relationship the level of asn358 deamidationvariant can be minimized and controlled consistently in the currentprocess for producing clinical and commercial supplies', 'acknowledgmentswe acknowledge timothy pabst and thomas linke for providingthe moxetumomab pasudotox material leeann machiesky anderika farmer for biological activity testing and irma vainshtein forthe internalization assay', ' we thank ben niu and xiaoyu chen forreviewing and editing the manuscript', ' editorial support was provided by deborah shuman', ' all are employees of astrazeneca', 'appendix a', ' supplementary datasupplementary data to this article can be found online athttpsdoi', 'org10', '1016j', 'xphs', '2020', '06', '002', '', '', '', '', '1', ' kinch ms griesenauer rh', ' 2017 in review fda approvals of new molecularentities', ' drug discov today', ' 201823814691473', '2', ' leader b baca qj golan de', ' protein therapeutics a summary and pharmacological classiﬁcation', ' nat rev drug discov', ' 2008712139', '3', ' jenkins n', ' modiﬁcations of therapeutic proteins challenges and prospects', 'cytotechnology', ' 20075313121125', '4', ' manning mc chou dk murphy bm payne rw katayama ds', ' stability ofprotein pharmaceuticals an update', ' pharm res', ' 2010274544575', '5', ' capasso s salvadori s', ' effect of the threedimensional structure on the deamidation reaction of ribonuclease a', ' j pept res', ' 1999545377382', '6', ' capasso s mazzarella l sica f zagari a', ' deamidation via cyclic imide inasparaginyl peptides', ' pept res', ' 198922195200', '7', ' capasso s mazzarella l zagari a', ' deamidation via cyclic imide of asparaginylpeptides dependence on salts buffers and organic solvents', ' pept res', '199144234238', '8', ' shire sj', ' stability characterization and formulation development of recombinant human deoxyribonuclease i pulmozyme dornase alpha', ' pharm biotechnol', ' 19969393426', '9', ' alam me barnett gv slaney tr starr cg das tk tessier pm', ' deamidation cancompromise antibody colloidal stability and enhance aggregation in a phdependent manner', ' mol pharm', ' 201916519391949', '10', ' berkowitz sa engen jr mazzeo jr jones gb', ' analytical tools for characterizingbiopharmaceuticals and the implications for biosimilars', ' nat rev drug discov', '2012117527540', '11', ' wang h shu q frieden c gross ml', ' deamidation slows curli amyloidproteinaggregation', ' biochemistry', ' 2017562328652872', '12', ' oganesyan i lento c wilson dj', ' contemporary hydrogen deuterium exchangemass spectrometry', ' methods', ' 20181442742', '13', ' deng b lento c wilson dj', ' hydrogen deuterium exchange mass spectrometryin biopharmaceutical discovery and development a review', ' anal chim acta', '2016940820', '14', ' asomugha co gupta r srivastava op', ' structural and functional roles of deamidation of n146 andor truncation of nh2 or coohtermini in human abcrystallin', ' mol vis', ' 20111724072420', '15', ' barnett gv balakrishnan g chennamsetty n et al', ' probing the tryptophanenvironment in therapeutic proteins implications for higherorder structureon tryptophan oxidation', ' j pharm sci', ' 2019108619441952', '16', ' gupta r srivastava op', ' deamidation affects structural and functional properties of human alphaacrystallin and its oligomerization with alphabcrystallin', 'j biol chem', ' 2004279434425844269', '17', ' yan y wei h fu y et al', ' isomerization and oxidation in the complementaritydetermining regions of a monoclonal antibody a study of the modiﬁcationstructurefunction correlations by hydrogendeuterium exchange mass spectrometry', ' anal chem', ' 201688420412050', '18', ' hageman t wei h kuehne p et al', ' impact of tryptophan oxidation incomplementaritydetermining regions of two monoclonal antibodies onstructurefunction characterized by hydrogendeuterium exchange massspectrometry and surface plasmon resonance', ' pharm res', ' 201836124', '19', ' zhang a hu p macgregor p et al', ' understanding the conformational impact ofchemical modiﬁcations on monoclonal antibodies with diverse sequencevariation using hydrogendeuterium exchange mass spectrometry and structural modeling', ' anal chem', ' 201486734683475', '20', ' noguchi s satow y uchida t sasaki c matsuzaki t', ' crystal structure of ustilago sphaerogena ribonuclease u2 at 1', '8 a resolution', ' biochemistry', '199534471558315591', '21', ' noguchi s miyawaki k satow y', ' succinimide and isoaspartate residues in thecrystal structures of hen eggwhite lysozyme complexed with trinacetylchitotriose', ' j mol biol', ' 19982781231238', '22', ' esposito l vitagliano l sica f sorrentino g zagari a mazzarella l', ' the ultrahigh resolution crystal structure of ribonuclease a containing an isoaspartylresidue hydration and stereochemical analysis', ' j mol biol', ' 20002973713732', '23', ' rester u moser m huber r bode w lisoaspartate', ' 115 of porcine betatrypsin promotes crystallization of its complex with bdellastasin', ' acta crystallogr d biol crystallogr', ' 200056pt 5581588', '24', ' eschenburg s schonbrunn e', ' comparative xray analysis of the unligandedfosfomycintarget mura', ' proteins', ' 2000402290298', '25', ' noguchi s', ' structural changes induced by the deamidation and isomerizationof asparagine revealed by the crystal structure of ustilago sphaerogena ribonuclease u2b', ' biopolymers', ' 2010931110031010', '26', ' mallagaray a creutznacher r dulfer j et al', ' a posttranslational modiﬁcationof human norovirus capsid protein attenuates glycan binding', ' nat commun', '20191011320', '27', ' kreitman rj pastan i', ' antibody fusion proteins anticd22 recombinantimmunotoxin moxetumomab pasudotox', ' clin cancer res', ' 2011172063986405', 'x', ' lu et al', '  journal of pharmaceutical sciences 109 2020 2676268328', ' dhillon s', ' moxetumomab pasudotox ﬁrst global approval', ' drugs', ' 2018781617631767', '29', ' mohseni m uludag h brandwein jm', ' advances in biology of acute lymphoblastic leukemia all and therapeutic implications', ' am j blood res', ' 2018842956', '30', ' linke t feng j yu k et al', ' process scale separation of an anticd22 immunotoxin charge variant', ' j chromatogr a', ' 20121260120125', '31', ' linke t aspelund mt thompson c et al', ' development and scaleup of acommercial fed batch refolding process for an anticd22 two chain immunotoxin', ' biotechnol prog', ' 201430613801389', '268332', ' ionescu rm vlasak j price c kirchmeier m', ' contribution of variable domainsto the stability of humanized igg1 monoclonal antibodies', ' j pharm sci', '200897414141426', '33', ' jorgensen r merrill ar yates sp et al', ' exotoxin aeef2 complex structureindicates adp ribosylation by ribosome mimicry', ' nature', ' 20054367053979984', '34', ' li m dyda f benhar i pastan i davies dr', ' crystal structure of the catalyticdomain of pseudomonas exotoxin a complexed with a nicotinamide adeninedinucleotide analog implications for the activation process and for adpribosylation', ' proc natl acad sci u s a', ' 1996931469026906', '', ''], 'Development Of Muco Adhesive Orally Disintegrating Tablets Containing Tamarind Gum Coated Tea Powder': ['international journal of pharmaceutics x 1 2019 100012contents lists available at sciencedirectinternational journal of pharmaceutics xjournal homepage www', 'journals', 'elsevier', 'cominternationaljournalofpharmaceuticsxdevelopment of mucoadhesive orally disintegrating tablets containingtamarind gumcoated tea powders for oral caretrika kiniwaa masaki miyakeb shinichiro kimuraa shigeru itaia hiromu kondoayasunori iwaoaalaboratory of pharmaceutical engineering and drug delivery science school of pharmaceutical sciences university of shizuoka 521 yada surugaku shizuoka 4228526 japanblaboratory of microbiology and immunology school of pharmaceutical sciences university of shizuoka 521 yada surugaku shizuoka 4228526 japanarticle info', 'keywordsoral careorally disintegrating tablettea powdermicrowaveadhesive propertytamarind gumthe aim of this study was to design and evaluate mucoadhesive orally disintegrating tablets manufactured bymicrowave irradiation and containing polysaccharide', ' we prepared orally disintegrating tea tablets odttscontaining a 1 ww mass fraction of one of ﬁve polysaccharides gum arabic carrageenan guar gum tamarindgum or pectin and evaluated the swelling degree tablet hardness friability disintegration time and adhesiveproperties', ' all tablets had a swelling degree of about 1 mm a hardness of over 13 n and a friability degreeof  1', ' tablets containing gum arabic and tamarind gum had disintegration times of 30 s or less and satisﬁedrequirements as orally disintegrating tablets', ' this could be attributed to their high void contents which allowedfor water penetration', ' the adhesive properties and particle retention ratios were highest in odtts containingtamarind gum which was thought to be caused by the rapid disintegration and high viscosity of the tamarindgum itself', ' when we investigated changing the mass fraction of tamarind gum we found 1 ww was mostsuitable for rapid disintegration and high adhesiveness', ' the odtts containing 1 ww tamarind gum showedsigniﬁcant growth inhibition towards streptococcus mutans', ' therefore microwave irradiation technology andaddition of tamarind gum could be used to manufacture mucoadhesive orally disintegrating tablets for oral care', '1', ' introductionin the modern era the pneumonia death rate has been increasingwith population aging and superaging societies miyashita andyamauchi 2018', ' over 90 of pneumonia deaths are of older adultsaged 65 years or older and about 70 of older adults suﬀering frompneumonia have aspiration pneumonia teramoto et al', ' 2008 baineet al', ' 2001', ' aspiration pneumonia is caused by bacteria or othercontaminants that enter the trachea because of decreased swallowingfunction i', 'e', ' deglutition reﬂex and cough reﬂex manabe et al', '2015 which is common in the older adult ebihara et al', ' 2016 perryet al', ' 2001 li et al', ' 2015', ' therefore it is important to keep the oralcavities of older adults clean to prevent aspiration pneumonia', ' in addition eﬀective oral care can prevent intraoral diseases e', 'g', ' periodontal disease and dental caries and systemic diseases such as anginabrain infarction and diabetes that can be induced by intraoral disease', 'oral care preparations can improve quality of life for older adultslangmore et al', ' 1998 teramoto et al', ' 2015 especially if the preparations are easily handled and can be taken even by bedridden patients', 'methods used for oral care include tooth brushing mouthwashesand oral care supplements to control plaque derived from bacteria', ' indental caries some streptococcus mutans s', ' mutans produce insolubleglucan which various microorganisms adhere to and then generate acidand dissolve the tooth enamel leme et al', ' 2006 forssten et al', ' 2010', 'to prevent dental caries chlorhexidine has been used to decreaseplaque accumulation charles et al', ' 2004', ' however some side eﬀectssuch as tooth coloration tartar formation in gingival crevices and tastedisorders have been reported when it is used for more than 2 weeks', 'consequently it is best avoid longterm use of chlorhexidine wherepossible james et al', ' 2017', ' as other candidates polyphenols such astannins catechin quercetin and anthocyanin which are biologicalcomponents of certain plants and very safe have been reported to inhibit the formation of glucosyltransferase and bioﬁlms involved in theabbreviations ecg epicatechin gallate egc epigallocatechin egcg epigallocatechin gallate gcg gallocatechin gallate odts orally disintegrating tabletsodtts orally disintegrating tea tablets sem scanning electron microscopecorresponding author', 'email address yasuiwaoushizuokaken', 'ac', 'jp y', ' iwao', 'httpsdoi', 'org10', '1016j', 'ijpx', '2019', '100012received 18 december 2018 received in revised form 7 march 2019 accepted 3 april 2019available online 04 april 201925901567  2019 the authors', ' published by elsevier b', 'v', ' this is an open access article under the cc by licensehttpcreativecommons', 'orglicensesby4', '0', 'international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', 'odtts we selected thermally stable polysaccharides gum arabiccarrageenan guar gum tamarind gum and pectin', ' we determined theeﬀects of these polysaccharides on the mucoadhesive properties of thetablets for potential use as oral care preparations', 'production of insoluble glucan ferrazzano et al', ' 2009 percival et al', '2006 yamanakaokada et al', ' 2008', ' polyphenols have not only antibacterial activity but also antioxidant and antiinﬂammatory activitiesalmajano et al', ' 2008 jalil and ismail 2008 cavet et al', ' 2011', ' indiseases in the oral cavity such as dental caries and periodontal diseaseinﬂammation occurs as a host immune response towards bacteria', ' theuse of polyphenols with antioxidant and antiinﬂammatory activitiescan reduce inﬂammation caused by oral bacteria and keep the inside ofthe mouth clean', ' tea leaves contain many compounds with antimicrobial antioxidant and antiinﬂammatory activities and are acandidate for preparation of oral care products graham 1992', 'we recently developed a novel method for facile preparation oforally disintegrating tablets odts by microwave irradiation of wetmolded tablets containing mannitol sugar alcohol a polymeric disintegrant and water absorbent materials sano et al', ' 2011 sano et al', '2013 sano et al', ' 2014', ' odts are designed to dissolve in a smallamount of water in the oral cavity to enable patients with dysphagia orrestricted water intake to swallow tablets', ' they represent one of themost patientfriendly dosage forms wade et al', ' 2012 pﬁster andghosh 2005', ' in our methodology the microwave irradiation led to theformation of water vapor which resulted in the expansion of the poresinside the tablets and the formation of new void networks', ' these newvoid networks allowed for the water to penetrate into the tablet moreeﬃciently and resulted in a decrease in their disintegration time', ' inaddition the formation of water vapor during the microwave irradiation also led to the dissolutionprecipitation of some of the mannitolparticles which resulted in the formation of new solid bridges', ' theformation of new solid bridges between the mannitol particles led to anincrease in the hardness of the tablets', ' taken together this new methodtherefore makes it possible to prepare odts with opposing physicochemical properties such as rapid disintegration time and enhancedhardness', ' in addition we developed orally disintegrating tea tabletsodtts containing powdered tea leaves', ' these odtts disintegratedwithin the oral cavity within 30 s tanaka et al', ' 2016', ' in a preliminaryevaluation of antibacterial activity against s', ' mutans an odtt extractgreatly inhibited bacterial growth compared with artiﬁcial saliva', ' asthe disintegrated particles are kept in the oral cavity for a long time theantimicrobial action is sustained and this should increase the therapeutic eﬀect for oral care', ' if we could give odtts mucoadhesiveproperties the powdered tea that disintegrates in the oral cavity wouldadhere to the oral mucosa and exhibit sustained antibacterial actionagainst oral microbial ﬂora and provide eﬃcient oral care fig', ' 1', 'in the present study we tried to make mucoadhesive orally disintegrating tea tablets by adding polysaccharides', ' polysaccharides contain many connected monosaccharides and have diﬀerent types ofbonding and molecular weights wüstenberg 2015', ' polysaccharidescontain hydroxyl and carboxyl groups and their thickening or gellingaction is determined by the type and concentration of these groupsdickinson 2003', ' they are used in a wide range of applications infoods cosmetics oral care products and medicines avachat et al', '2011 nayak et al', ' 2014 datta and bandyopadhyay 2006', ' mucin themain component of oral mucosa reportedly strengthens interactionswith hydrogen bond donors in the solute and polysaccharides containing many hydroxyl and carboxyl groups interact with mucin caronet al', ' 2015', ' this allows powdered tea to attach to the oral cavity viapolysaccharides', ' because we used microwave irradiation to prepare the2', ' materials and methods2', '1', ' materialsoolong tea leaves utonrousousuisen were purchased from thebanboo cakan chinese tea ceremony kochi japan', ' dmannitolwas purchased in its β crystalline form from merck ltd tokyo japan', 'lowsubstituted hydroxypropyl cellulose lhpc mean particle size45 µm hydroxyepoxy group nbd020 was supplied by shinetsuchemical co', ' ltd tokyo japan', ' polyvinylpyrrolidone pvpkollidon 25 was obtained from basf japan tokyo japan', ' gumarabic gum arabic hp powder carrageenan sheepy gum fa guargum guar pack pf20 tamarind gum glyroid 6c and pectin hfpectin classic af701 were purchased from dsp gokyo food andchemical osaka japan', ' yeast nitrogen base without amino acids waspurchased from nippon becton dickinson co', ' ltd tokyo japan', 'glucose ammonium sulfate polypeptone s and monopotassiumphosphate were purchased from wako pure chemical industries ltdosaka japan', ' brain heart infusion was purchased from nissuipharmaceutical co', ' ltd', ' tokyo japan', ' all other reagents used wereof the highest grade available from commercial sources', '2', '2', ' design of mucoadhesive tablet formulations containingpolysaccharidecoated tea powders2', '2', '1', ' formulation of odtts containing polysaccharidesodtts were prepared using an established method with a slightmodiﬁcation tanaka et al', ' 2016', ' oolong tea leaves were groundusing a standard tea grinder teaﬁne mutow shizuoka japan', ' theresulting powder was sieved through a 75µm screen and 32 ww ofthe powdered tea was placed in a mortar', ' a 1', '68 m na2hpo4 aqueoussolution 40 ww mass fraction of the powdered tea mass for use asan adsorption solvent was then dropped into the mortar using a pipetteand the resulting mixture was stirred using a pestle to obtain a homogenous mixture', ' polysaccharide 1 ww mass fraction of the totalmass of mixed powder was added and it adsorbed onto and coated thepowdered tea surface', ' the odtt formulations are summarized intable 1', ' dmannitol 55 ww or 56 ww lhpc 10 ww andpvp 2 ww were then added and the resulting mixture was blendedwith the pestle', ' an additional portion of distilled water 45 ww massfraction of the total mass of mixed powder was then added to themortar as a granulation solvent and the resulting mixture was granulated for approximately 1 min', ' a portion 60 mg of the wet granuleswas compressed using a compression test apparatus mpc100 okadaseiko tokyo japan ﬁtted with several punches ø 5 mm', ' consideringthe further development of tablets which are easily handled and can betaken even by bedridden patients smaller sized tablet ø 5 mm wasselected', ' a compression force of 0', '43 kn was used for tablet preparation', ' the wet molded tablets were heated in a microwave oven neeh226 panasonic osaka japan at 500 w which gave a reactiontemperature of 140 c', ' after microwave treatment the tablets werefig', ' 1', ' illustration of the interaction between oralmucosa and powdered tea after tablet disintegration', '2international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', 'were repeated three times and the average values were calculated', 'table 1odtt formulations containing polysaccharides', '2', '3', '4', ' disintegration timethe disintegration time was measured using an odt tester odmate imotoseisakusyo kyoto japan', ' the bottom surface on which thetablets were placed was 4 mm mesh', ' the tablet was placed in the centerof the mesh and the tester loading tool was placed on the top of thetablet', ' an aliquot 10 ml of artiﬁcial saliva which contained distilledwater 1 l nacl 1', '44 g kcl 1', '47 g and tween 80 3 g and was at37 c was placed in a beaker and stirred at 1000 rpm', ' the tabletsandwiched between the loading tool and the bottom surface waslowered in the beaker to the predetermined position', ' the disintegrationtime was recorded as the period between when the tester arm waslowered to the predetermined position and when the loading tool touched the bottom of the mesh', ' the start and end points of each measurement were recorded by a photo microsensor', ' the maximum disintegration time for these experiments was set to 120 s', ' all of themeasurements were repeated three times and the average values werecalculated', 'dried in a thermostatic chamber at 80 c for 24 h', '2', '2', '2', ' formulation of odtts with various tamarind gum mass fractionswe formulated odtts with various tamarind gum mass fractionstable 2', ' the mass fractions of powdered tea lhpc and pvp did notchange therefore 32 ww of the powdered tea 10 ww of lhpcand 2 ww of pvp were used', ' the preparation method was similar tothat described in section 2', '2', '1', '2', '3', '5', ' adhesive property of the tabletsthe adhesive properties of the tablets were measured using a tabletype tensile compression testing machine force tester mct2150 adco', ' ltd', ' tokyo japan ikeuchitakahashi et al', ' 2013', ' the tablet tobe analyzed was ﬁxed with doublesided tape to the movable adapter', 'then a mucin layer 10 wv was prepared to the ﬁxed adapter', 'artiﬁcial saliva 50 μl was placed on the mucin layer and the movableadapter with tablet was placed in contact with the mucin layer', ' afterconﬁrming that the tablet was in contact with the artiﬁcial saliva andmucin layer and maintaining for 20 s the movable adapter was raisedsupplemental fig', ' 1a', ' the load at that time was measured and theadhesiveness was calculated from the load and the tablet area using eq', '2', ' all of these measurements were repeated three times and theaverage values were calculated', '2', '3', ' characterization of odtts2', '3', '1', ' swelling degreethe degree of swelling was calculation according to eq', ' 1', 'swelling degree  thickness treated  thicknessuntreated 1where thicknesstreated and thicknessuntreated are the thickness of themicrowave treated and untreated tablets respectively', ' the thickness ofeach tablet was measured with a micrometer with a precision of0', '01 mm cd20 mitsutoyo corporation kanagawa japan', ' three tablets were randomly selected for thickness measurements and theaverage values were used for subsequent calculations', 'adhesiveness 2', '3', '3', ' friabilitythe tablet friability was determined using a tablet friability testerfriabilator toyama sangyo osaka japan in accordance with theprocedure described in the seventeenth edition of the japanesepharmacopoeia oseiyeboah and sun 2015', ' all the measurementsparticle retention ratiobefore drop treatment g   after drop treatment g before drop treatment g 2', '3', '6', ' particle retention ratioeach tablet was pulverized with a mortar and pestle and 100 mg ofthe pulverized powders which have same particle size and particle sizedistribution analyzed by a laser diﬀraction particle size analyzermastersizer2000 marvern worcestershire ukdata not shown wassuspended in 1 ml of artiﬁcial saliva', ' for analysis a mucin layer 10 wv was prepared on a glass slide', ' the glass slide was inclined at 15and the suspension was dropped on it at a rate of 1 mlminsupplemental fig', ' 1b', ' the weights of the suspension before and afterthe test were used to calculate particle retention ratio on the mucinlayer eq', ' 3', ' all of these measurements were repeated three timesand the average values were calculated', '2', '3', '2', ' tablet hardnessthe tablet fracture strength was deﬁned as the force required tobreak the tablet by radial compression', ' the tablet hardness was determined using a tablet hardness tester pc30 okada seiko tokyojapan', ' all of these measurements were repeated three times and theaverage values were calculated', '0', '5load n tablet area m232', '3', '7', ' tablet surfacethe tablet surface was observed using a scanning electron microscope miniscopetm3030 hitachi hightechnologies co', ' tokyojapan', '2', '3', '8', ' polysaccharide viscositythe viscosity was measured using a viscometer rv dv 2 t ekokoseiki co', ' ltd', ' tokyo japan after dissolving 10 mg of each polysaccharide gum arabic carrageenan guar gum tamarind gum orpectin in 1 ml of 1', '68 m aqueous na2hpo4 with stirring for 1 min at3international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', 'fig', ' 2', ' tablet properties of orally disintegrating tea tablets manufactured using polysaccharides', ' a swelling degree b hardness c friability d disintegrationtime e adhesive property with tablets and f particle retention ratio', ' p  0', '05 and p  0', '01 versus the tablets without polysaccharide f1', ' each columnrepresents the mean  s', 'd', ' n  3', 'shimadzu kyoto japan to determine the amounts of epigallocatechingallate egcg', ' a mixture of methanol solvent a and puriﬁed watersolvent b which was deaerated ultrasonically for more than 10 min inadvance was used as the mobile phase with a ﬂow rate of 1', '0 mlmin', 'quantiﬁcation was carried out on tsk ods80tm 150 mm  4', '6 mm5 µm', ' the column temperature was 40 c and the sample volume was5 µl', ' the detector was set at 280 nm', ' for the elution program theproportion of solvent a was increased from 10 to 50 from 0 to30 min', 'in addition to completely elute the egcg from the oolong tealeaves further incubation 100 rpm 1 h was performed after dissolution test and the total amount of egcg was determined', ' the ratio ofegcg released into the medium  was quantitatively obtained bydividing by the total amount of egcg', '12 rpm', ' measurements were carried out at 25 c and 80 c', ' all of thesemeasurements were repeated three times and the average values werecalculated', '2', '3', '9', ' dissolution of epigallocatechin gallatea dissolution test was performed for polysaccharidefree tabletswithout microwave f1without microwave odtts with microwavef1 tablets containing 1 ww tamarind gum without microwave f5without microwave and odtts containing 1 ww mass fractiontamarind gum with microwave f5 using the paddle apparatus', ' eachtest was performed by placing 10 tablets in each vessel which was ﬁlledwith 150 ml of ph 6', '8 phosphate buﬀer solution and kept at37  0', '5 c', ' the paddle speed was adjusted to 50 rpm', ' samples weretaken after 5 10 min 20 min 30 min 1 h and 2 h', ' the samples wereﬁltered through a ﬁlter with a pore size of 0', '20 µm and then applied forhighperformance liquid chromatography hplc lc2010cht4international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', 'fig', ' 3', ' scanning electron micrographs of the surfaces of orally disintegrating tea tablets manufactured using polysaccharides', ' magniﬁcation 600 f1 f2 f3 f4f5 and f6', ' yellow triangles indicated the void with a diameter of over 3 μm', ' for interpretation of the references to colour in this ﬁgure legend the reader isreferred to the web version of this article', 'of the resulting mixture was adjusted to 7', '1 with a sodium hydroxidesolution', ' this mixture was used as the catechin medium', ' the catechinmedium 8 ml test solution 1 ml and s', ' mutans 270 µl were cultured for 24 h in brain heart infusion in a boiling tube', ' thereaftercultivation was carried out at 37 c', ' the turbidity at 651', '5 nm wasmeasured at 0 3 5 and 7 h using a spectrophotometer uvmini1240shimadzu co', ' and used for determination of growth inhibition', ' thesample containing artiﬁcial saliva was designated as the control forcomparison purposes', ' all of these measurements were repeated threetimes and the average values were calculated', '2', '4', ' antibacterial eﬀect2', '4', '1', ' preparation of test solutionsfive polysaccharidefree tablets without microwave f1withoutmicrowave five odtts with microwave f1 five tablets containing1 ww tamarind gum without microwave f5without microwaveand five odtts containing 1 ww tamarind gum with microwavef5 were incubated in separate 10ml aliquots of artiﬁcial saliva for1 h at 37 c', ' after 10 min of sonication centrifugation was performedfor 20 min', ' each supernatant was ﬁltered through a 0', '20μm sterilizingﬁlter to prepare a test solution', '2', '5', ' statistical analysis2', '4', '2', ' quantitative analysis of catechinsquantiﬁcation of catechins epicatechin gallate ecg gallocatechin gallate gcg epigallocatechin egc and egcg in the prepared tablets was carried out by hplc lc2010cht in the samemanner described in section 2', '3', '9', 'all date were expressed as the mean  standard deviation', ' in tablets properties the statistical signiﬁcance of diﬀerences betweenodtts with microwave f1 and odtts with each polysaccharide aswell as between odtts containing 1 ww tamarind gum with microwave f5 and odtts containing 0', '5 3 and 5 ww tamarind gumwith microwave was determined using anova', ' pvalues  0', '05 wereconsidered to be statistically signiﬁcant', '2', '4', '3', ' evaluation of the antibacterial eﬀectyeast nitrogen base without amino acids 4 g glucose 2', '5 gammonium sulfate 2', '5 g polypeptone s 1 g monopotassium phosphate 0', '5 g and water 1000 ml were added to a beaker and the ph5international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', '3', ' results and discussiongum had higher viscosities than other polysaccharides at 25 c', ' weassumed that this was caused by aggregation of polysaccharide molecules by dehydration of saccharides and alcohols and by formation ofhigherorder networks by hydrogen bonding of saccharides and alcohols with polysaccharide molecules', ' from these results we consideredthat artiﬁcial saliva rapidly inﬁltrated into f5 in the 20 s and the tamarind gum dissolved', ' the adhesiveness was high in this case becausetamarind gum strongly bound to mucin via hydrogen bonding', ' guargum also had a high viscosity like tamarind gum but the adhesivenessof the tablet containing guar gum was not as high as that of f5', ' weconsidered that this diﬀerence was caused by the permeability of theodtts', ' a small air gap was observed in f4 and it had a disintegrationtime of 120 s fig', ' 3 so the permeability to f4 appeared to be lowerthan that of f5', ' therefore despite the high viscosity the amount ofguar gum dissolved was small and the adhesiveness of f4 was lowerthan that of f5', ' for the particle retention ratio although bonding between the pulverized tablet particles and the mucin layer was relativelyhigh fig', ' 2f f4 had a disintegration time of 120 s or more', 'in summary although there were no diﬀerences in the swellingdegree hardness and friability among the formulations f2 and f5quickly disintegrated within 30 s and f5 had high adhesiveness properties and a high particle retention ratio', '3', '1', ' evaluation of odtts containing polysaccharides 1 ww massfractionthe degree of swelling hardness friability disintegration timeadhesiveness and particle retention ratio results are shown in fig', ' 2', 'the degree of swelling did not diﬀer between formulations and allformulations swelled by about 1 mm fig', ' 2a', ' this suggests that whenthe wet tablet was microwave irradiated water vapor inside the tabletevaporated and the tablet swelled', ' suﬃcient swelling should shortenthe disintegration time', ' the results of our previous study showed thatswelling of over 0', '2 mm was suﬃcient for shortening the disintegrationtime of odts sano et al', ' 2011', ' all formulations had hardness valuesof over 13 n fig', ' 2b which is suﬃcient hardness for a 5mm diametertablet tanaka et al', ' 2016', ' this is because the excipient dmannitolmelts at 168 c and forms strong particletoparticle bonds during microwave irradiation', ' in addition because of the high hardness thefriability was  1 in all formulations fig', ' 2c', ' however the disintegration times were more than 120 s for f3 f4 and f6 which contained carrageenan guar gum and pectin respectively fig', ' 2d', ' bycomparison f1 and f2 which contained gum arabic and f5 whichcontained with tamarind gum had disintegration times of  30 s', ' according to the food and drug administration odts should disintegratewithin 30 s fda 2008', ' the disintegration times of f1 f2 and f5satisﬁed this requirement', 'we also observed the surfaces of the tablets by sem fig', ' 3', ' manysmall voids diameter over 3 μm were observed in f1 f2 and f5whereas few voids were observed in f3 f4 and f6', ' generally as thenumber of voids increases the water permeation to the interior of thetablet increases and the disintegration time decreases kondo et al', '2012', ' by contrast as the number of voids decreases the water permeation decreases and the disintegration time increases', ' therefore thedisintegration times indicate that f1 f2 and f5 have many voids andgood water permeation', 'among the tablets f5 showed the highest adhesiveness with themucin layer fig', ' 2e and f', ' the high adhesiveness of tamarind gummight be caused by its viscosity', ' we measured the viscosities of thepolysaccharides at 25 c and 80 c fig', ' 4', ' guar gum and tamarind3', '2', ' eﬀect of the tamarind gum concentration on physicochemicalproperties of the odttsour results showed that odtts containing tamarind gum had goodhardness rapid disintegration and high adhesiveness', ' therefore weinvestigated the eﬀect of the tamarind gum mass fraction on physicochemical properties of the odtts', ' we measured the degree of swellinghardness friability disintegration time adhesiveness and particle retention ratio for tablets with tamarind gum mass fractions of 0', '5 1 3and 5 ww fig', ' 5', ' for odtts with tamarind gum mass fractions of0', '5 and 1 ww the degree of swelling was about 1 mm but as thetamarind gum mass fraction increased to 3 and 5 ww the degree ofswelling decreased to about 0', '5 mm fig', ' 5a', ' this is because a gel wasformed in the tablet as the proportion of tamarind gum increased andeven though microwave irradiation was carried out the water vaporcould not suﬃciently expand the tablet', ' the hardness values were over13 n in all formulations fig', ' 5b', ' because of the high hardness allformulations had friability values of  1 fig', ' 5c which suggeststhat the hardness is enough', ' when the tamarind gum mass fraction was0', '5 or 1 ww the disintegration time was  30 s fig', ' 5d howeveras the tamarind gum mass fraction increased the disintegration timeincreased to  60 s', 'when we observed the tablet surfaces by sem many voids wereobserved in odtts containing 0', '5 and 1 ww mass fraction tamarind gum whereas hardly any voids were observed in odtts containing 3 and 5 ww mass fraction tamarind gum fig', ' 6', ' as discussed above with an increase in the viscosity of tamarind gum thesurface voids would disappear', ' this indicates that the lack of voidsprevents water permeation into the tablet and extends the disintegration time', 'the adhesive properties of the tablets increased as the mass fractionof tamarind gum increased fig', ' 5e', ' because of the increase in thetamarind gum mass fraction the viscosity increased and the bond withthe mucin layer became stronger', ' this increased the load and the adhesiveness increased', ' in addition as the mass fraction of tamarind gumincreased the particle retention ratio increased fig', ' 5f', ' it is thoughtthat as the content of tamarind gum bonded to the mucin layer increased the adhesiveness increased', ' therefore although an increase inthe mass fraction of tamarind gum tended to enhance the adhesivenessof the tablet addition of 1 ww tamarind gum produced tablets withsuﬃcient hardness disintegration and adhesiveness', 'fig', ' 4', ' viscosities of polysaccharides dissolved in a 1', '68 m na2hpo4 solution', 'a 25 c and b 80 c', ' p  0', '05 and p  0', '01 versus gum arabic', ' eachcolumn represents the mean  s', 'd', ' n  3', '6international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', 'fig', ' 5', ' properties of orally disintegrating tea tablets manufactured using tamarind gum', ' a swelling degree b hardness c friability d disintegration time eadhesiveness and f particle retention ratio', ' p  0', '05 and p  0', '01 versus the tablets with 1 ww tamarind gum', ' each column represents the mean  s', 'd', 'n  3', 'microwave treated tablets f1 and f5 showed rapid dissolutioncompared with tablets prepared without microwave', ' this was becausethe powdered tea became friable at the high temperature induced bymicrowave irradiation and this increased the egcg dissolution', '3', '3', ' evaluation of the dissolution behavior of egcgwe studied the dissolution behavior of egcg which is an activecompound in tea leaves fig', ' 7', ' we examined its dissolution usingodtts containing 1 ww mass fraction tamarind gum and preparedwith microwave f5', ' these tablets showed rapid disintegration andhigh adhesiveness', ' in addition we carried out a dissolution test withpolysaccharidefree tablets without microwave f1without microwave odtts with microwave f1 and tablets containing 1 wwmass fraction tamarind gum without microwave f5without microwave', ' f1 showed the highest dissolution rate until 30 min and after1 h all tablets showed dissolution rates of almost 90', ' compared withf1 and f5 even with the addition of tamarind gum f5 showed a dissolution rate of 90 or more after 1 h', ' therefore addition of tamarindgum hardly aﬀected the dissolution rate of egcg', ' in addition3', '4', ' quantitative analysis of catechinin addition to the dissolution study of egcg we extracted otheractive compounds from the tablets and performed quantitative analysesfor further antibacterial studies', ' the quantitative values for all compounds ecg gcg egc and egcg table 3 were lower after microwave treatment than before', ' this indicates that they were likelyconverted to other compounds by microwave irradiation or decomposed', ' however even when tamarind gum was added fast dissolutionwas observed compared with the tablet without tamarind gum', ' this7international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', 'fig', ' 6', ' scanning electron micrographs of the surfaces of orally disintegrating tea tablets manufactured using tamarind gum', ' magniﬁcation 40 0', '5 1 3 and 5 ww', 'fig', ' 7', ' dissolution proﬁle of egcg from polysaccharidefree odtts withwithout microwave and odtts containing 1 ww mass fraction tamarindgum withwithout microwave', ' each symbol represents the mean  s', 'd', 'n  3', 'suggests that tamarind gum does not aﬀect the active ingredients contents ecg gcg egc and egcg', 'fig', ' 8', ' evaluation of the antibacterial eﬀects when extracts from tablets weretreated', ' p  0', '01 versus control', ' each symbol represents the mean  s', 'd', 'n  3', '3', '5', ' evaluation of the antibacterial eﬀectnext we studied the antimicrobial activity against s', ' mutansfig', ' 8', ' the vertical axis represents the absorbance at 651', '5 nm', ' ap  0', '05 and p  0', '01 versus f1without microwave group', ' p  0', '01 versus f5without microwave', ' each value represents the mean  s', 'd', ' n  3', '8international journal of pharmaceutics x 1 2019 100012r', ' kiniwa et al', 'appendix a', ' supplementary datahigher absorbance value means s', ' mutans is proliferating whereas alower absorbance value means that growth of s', ' mutans is suppressed', 'the absorbance of the control gradually increased with time andmarked proliferation of s', ' mutans was observed', ' in all formulations theabsorbances were markedly low and little bacterial growth was observed indicating that all formulations had growth inhibitory eﬀects', 'from the results of dissolution tests we found egcg had a dissolutionrate of 90 or more at 1 h fig', ' 7', ' therefore although the amounts ofthe active compound in f1 and f5 were a little bit lower than those intablets prepared without microwave irradiation suﬃcient egcg waspresent to show antibacterial activity', ' overall the slight diﬀerences oftotal amounts of egcg did not aﬀect the antibacterial properties', ' previously egcg have been reported to inhibit the formation of glucosyltransferases and bioﬁlms at 500 µgml koo et al', ' 2002 which issimilar to our results', ' we can conclude that polyphenols extracted fromtea leaves seems show signiﬁcant growth inhibitory eﬀects', 'supplementary data to this article can be found online at httpsdoi', 'org10', '1016j', 'ijpx', '2019', '100012', '', '', '', '', '', '', 'almajano m', 'p', ' carbó r', ' jiménez j', 'a', 'l', ' gordon m', 'h', ' 2008', ' antioxidant and antimicrobial activities of tea infusions', ' food chem', ' httpsdoi', 'org10', '1016j', 'foodchem', '2007', '10', '040', 'avachat a', 'm', ' dash r', 'r', ' shrotriya s', 'n', ' 2011', ' recent investigations of plant basednatural gums mucilages and resins in novel drug delivery systems', ' indian j', ' pharm', 'educ', ' res doinill', 'baine w', 'b', ' yu w', ' summe j', 'p', ' 2001', ' epidemiologic trends in the hospitalization ofelderly medicare patients for pneumonia 19911998', ' am', ' j', ' public health 9111211123', ' httpsdoi', 'org10', '2105ajph', '91', '7', '1121', 'caron g', ' visentin s', ' pontremoli c', ' ermondi g', ' 2015', ' proﬁle of the intermolecularforces governing the interaction of drugs with mucin', ' int', ' j', ' pharm', ' httpsdoi', 'org10', '1016j', 'ijpharm', '2015', '04', '058', 'cavet m', 'e', ' harrington k', 'l', ' vollmer t', 'r', ' ward k', 'w', ' zhang j', 'z', ' 2011', ' antiinﬂammatory and antioxidative eﬀects of the green tea polyphenol epigallocatechingallate in human corneal epithelial cells', ' mol', ' vis', 'charles c', 'h', ' mostler k', 'm', ' bartels l', 'l', ' mankodi s', 'm', ' 2004', ' comparative antiplaqueand antigingivitis eﬀectiveness of a chlorhexidine and an essential oil mouthrinse 6month clinical trial', ' j', ' clin', ' periodontol', ' httpsdoi', 'org10', '1111j', '1600051x', '2004', '00578', 'x', 'datta r', ' bandyopadhyay a', 'k', ' 2006', ' a new nasal drug delivery system for diazepamusing natural mucoadhesive polysaccharide obtained from tamarind seeds', ' saudipharm', ' j', 'dickinson e', ' 2003', ' hydrocolloids at interfaces and the inﬂuence on the properties ofdispersed systems', ' food hydrocoll', ' httpsdoi', 'org10', '1016s0268005x01001205', 'du x', ' huang x', ' huang c', ' wang y', ' zhang y', ' 2012', ' epigallocatechin3gallateegcg enhances the therapeutic activity of a dental adhesive', ' j', ' dent', ' 40 485492', 'httpsdoi', 'org10', '1016j', 'jdent', '2012', '02', '013', 'ebihara s', ' sekiya h', ' miyagi m', ' ebihara t', ' okazaki t', ' 2016', ' dysphagia dystussiaand aspiration pneumonia in elderly people', ' j', ' thorac', ' dis', ' 8 632639', ' httpsdoi', 'org10', '21037jtd', '2016', '02', '60', 'fda 2008', ' guidance for industry orally disintegrating tablets', ' cent', ' drug eval', ' res', 'httpsdoi', 'org10', '3354ab00285', 'ferrazzano g', 'f', ' amato i', ' ingenito a', ' de natale a', ' pollio a', ' 2009', ' anticariogeniceﬀects of polyphenols from plant stimulant beverages cocoa coﬀee tea', 'fitoterapia', ' httpsdoi', 'org10', '1016j', 'ﬁtote', '2009', '04', '006', 'forssten s', 'd', ' björklund m', ' ouwehand a', 'c', ' 2010', ' streptococcus mutans caries andsimulation models', ' nutrients', ' httpsdoi', 'org10', '3390nu2030290', 'graham h', 'n', ' 1992', ' green tea composition consumption and polyphenol chemistry', 'prev', ' med', ' baltim', ' httpsdoi', 'org10', '1016009174359290041f', 'ikeuchitakahashi y', ' sasatsu m', ' onishi h', ' 2013', ' evaluation of matrix type mucoadhesive tablets containing indomethacin for buccal application', ' int', ' j', ' pharm', 'httpsdoi', 'org10', '1016j', 'ijpharm', '2013', '06', '007', 'jalil a', 'm', 'm', ' ismail a', ' 2008', ' polyphenols in cocoa and cocoa products is there a linkbetween antioxidant properties and health molecules', ' httpsdoi', 'org10', '3390molecules13092190', 'james p', ' worthington h', 'v', ' parnell c', ' harding m', ' lamont t', ' cheung a', ' wheltonh', ' riley p', ' 2017', ' chlorhexidine mouthrinse as an adjunctive treatment for gingivalhealth', ' cochrane database syst', ' rev', ' httpsdoi', 'org10', '100214651858', 'cd008676', 'pub2', 'kondo k', ' niwa t', ' danjo k', ' 2012', ' evaluation of disintegration properties of orallyrapidly disintegrating tablets using a novel disintegration tester', ' chem', ' pharm', ' bull', 'httpsdoi', 'org10', '1248cpb', 'c1200307', 'koo h', ' pearson s', 'k', ' scottanne k', ' abranches j', ' cury j', 'a', ' rosalen p', 'l', ' park y', 'k', 'marquis r', 'e', ' bowen w', 'h', ' 2002', ' eﬀects of apigenin and ttfarnesol on glucosyltransferase activity bioﬁlm viability and caries development in rats', ' oral microbiol', 'immunol', ' httpsdoi', 'org10', '1034j', '1399302x', '2002', '170602', 'x', 'langmore s', 'e', ' terpenning m', 's', ' schork a', ' chen y', ' murray j', 't', ' lopatin d', 'loesche w', 'j', ' 1998', ' predictors of aspiration pneumonia how important is dysphagia dysphagia 13 6981', ' httpsdoi', 'org10', '1007pl00009559', 'leme a', 'f', 'p', ' koo h', ' bellato c', 'm', ' bedi g', ' cury j', 'a', ' 2006', ' the role of sucrose incariogenic dental bioﬁlm formation  new insight', ' j', ' dent', ' res', ' httpsdoi', 'org10', '1177154405910608501002', 'li m', ' wang z', ' han w', 'j', ' lu s', 'y', ' fang y', 'z', ' 2015', ' eﬀect of feeding management onaspiration pneumonia in elderly patients with dysphagia', ' chinese nurs', ' res', ' 24044', ' httpsdoi', 'org10', '1016j', 'cnre', '2015', '09', '004', 'manabe t', ' teramoto s', ' tamiya n', ' okochi j', ' hizawa n', ' 2015', ' risk factors foraspiration pneumonia in older adults', ' plos one 10', ' httpsdoi', 'org10', '1371journal', 'pone', '0140060', 'miyashita n', ' yamauchi y', ' 2018', ' bacterial pneumonia in elderly japanese populations', 'japanese clin', ' med', ' med', ' httpsdoi', 'org10', '11771179670717751433', 'nayak a', 'k', ' pal d', ' santra k', ' 2014', ' tamarind seed polysaccharidegellan mucoadhesive beads for controlled release of metformin hcl', ' carbohydr', ' polym', ' httpsdoi', 'org10', '1016j', 'carbpol', '2013', '12', '031', 'oseiyeboah f', ' sun c', 'c', ' 2015', ' validation and applications of an expedited tabletfriability method', ' int', ' j', ' pharm', ' httpsdoi', 'org10', '1016j', 'ijpharm', '2015', '02', '061', 'percival r', 's', ' devine d', 'a', ' duggal m', 's', ' chartron s', ' marsh p', 'd', ' 2006', ' the eﬀect of4', ' conclusionswe used polysaccharides to prepare odtts with adhesive propertiesfor use as novel oral care preparations', ' the prepared odtts had aswelling degree of about 1 mm hardness of 13 n or more and friabilityof 1 or less', ' among the odtts those containing tamarind gum disintegrated in 30 s or less because there were many voids on the tabletsurface for water to penetrate', ' the adhesive properties and particleretention ratios were also highest in the odtts containing tamarindgum which could be attributed to the rapid disintegration and highviscosity of the tamarind gum itself', ' when we increased the tamarindgum mass fraction in the formulation the swelling degree decreased toabout 0', '5 mm and the disintegration time increased', ' this is because thethickening action of the gum increases as its mass fraction increasesand the tablet surface is covered by a gel', ' this prevents void and suppresses water penetration', ' although the adhesive properties and particle retention ratios increased as the mass fraction of tamarind gumincreased the disintegration time was adversely aﬀected', ' thereforeamong the mass fractions we studied 1 ww tamarind gum is best forpreparation of odtts', ' in our dissolution tests even with the addition oftamarind gum the dissolution rate was 90 or more after 1 h indicating that addition of tamarind gum hardly aﬀected the dissolutionrate of egcg', ' when we evaluated the antimicrobial activities of odttswithwithout 1 ww tamarind gum we observed growth inhibitionagainst s', ' mutans with all formulations', ' in summary odtts containing1 ww tamarind gum have suﬃcient hardness disintegration adhesiveness and antibacterial activity', ' especially du et al', ' demonstratedthat the dental adhesives containing 200 or 300 μgml egcg werefound to exhibit inhibitory eﬀect on the growth of s', ' mutans du et al', '2012 speculating that polyphenols extracted from odtts with mucoadhesive property might show signiﬁcant growth inhibitory eﬀects invivo', ' future studies using animal models with periodontal disease areneeded to determine whether the odtts with tamarind gum work asexpected in the oral cavity', ' if they do they could be used for selfmedication to contribute to the health of many people', 'declaration of interestnone', '', ''], 'Hollow Fiber Based Liquid Phase Microextraction': ['journal of pharmaceutical analysis 10 2020 109e122contents lists available at sciencedirectjournal of pharmaceutical analysisjournal homepage www', 'elsevier', 'comlocatejpareview paperhollow ﬁberbased liquid phase microextraction followed byanalytical instrumental techniques for quantitative analysis of heavymetal ions and pharmaceuticalswajid ali khan a muhammad balal arain a b  yadollah yamini c nasrullah shah atasneem gul kazi d stig pedersenbjergaard e  mohammad tajik cadepartment of chemistry abdul wali khan university mardan 23200 kpk pakistandepartment of chemistry university of karachi 75270 karachi pakistandepartment of chemistry tarbiat modares university p', ' o', ' box 14115175 tehran irandnational center of excellence in analytical chemistry university of sindh jamshoro 76080 sindh pakistaneschool of pharmacy university of oslo oslo norwaybcarticle info', 'article historyreceived 6 september 2019received in revised form9 december 2019accepted 11 december 2019available online 12 december 2019hollowﬁber liquidphase microextraction hflpme and electromembrane extraction eme areminiaturized extraction techniques and have been coupled with various analytical instruments for traceanalysis of heavy metals drugs and other organic compounds in recent years', ' hflpme and eme providehigh selectivity efﬁcient sample cleanup and enrichment and reduce the consumption of organic solvents to a few microliters per sample', ' hflpme and eme are compatible with different analytical instruments for chromatography electrophoresis atomic spectroscopy mass spectrometry andelectrochemical detection', ' hflpme and eme have gained signiﬁcant popularity during the recent years', 'this review focuses on hollow ﬁber based techniques especially hflpme and eme of heavy metals andpharmaceuticals published 2017 to may 2019 and their combinations with atomic spectroscopy uvvis spectrophotometry high performance liquid chromatography gas chromatography capillary electrophoresis and voltammetry', ' 2019 xian jiaotong university', ' production and hosting by elsevier b', 'v', ' this is an open access articleunder the cc byncnd license httpcreativecommons', 'orglicensesbyncnd4', '0', 'keywordshollow ﬁber liquid phase microextractionelectromembrane extractionheavy metalspharmaceuticalsinstrumental techniques1', ' introductionmost analytical methods include sample preparation prior to theinstrumental analysis', ' the purpose of the sample preparation is tomake the sample compatible with the analytical instrument toremove interfering matrix components and to enrich the targetanalytes to a detectable level 1', ' different sample preparationtechniques are available but liquidliquid extraction lle andsolidphase extraction spe have been the most popular ones 2', 'for several decades different microextraction variants of lle andspe have been developed', ' this was originally motivated byreduction or elimination of organic solvents 3 and was initiated bypeer review under responsibility of xian jiaotong university', ' corresponding author', ' corresponding author at department of chemistry abdul wali khan university mardan 23200 kpk pakistan', 'email addresses bilalku2004yahoo', 'com m', 'b', ' arain stig', 'pedersenbjergaardfarmasi', 'uio', 'no s', ' pedersenbjergaard', 'the invention of solidphase microextraction spme by pawliszynet al', ' 4 and liquidphase microextraction lpme by jeannot andcantwell 5', ' since the introduction of these innovative samplepreparation methods a variety of spme and lpme methods havebeen reported in the literature', ' headspace solid phase microextraction hsspme intube solid phase microextraction itspme thinﬁlm solid phase microextraction tfspme headspace liquid phase microextraction hslpme liquidliquidmicroextraction based on solidiﬁcation of ﬂoating organic dropletllmesfo and dispersive liquidliquid microextraction dllmeare examples in this direction 6e11', ' while spme has becomecommercially available lpme is still performed with laboratorybuilt devices', ' in spite of this lpme is still a very active area ofresearch for reasons including 1 simplicity 2 costs 3 greenchemistry 4 selectivity and 5 method sensitivity', ' fig', ' 1 illustratesdifferent conﬁgurations and approaches to lpme', ' lpme was originally performed as single drop microextraction sdme 12', ' sdmeis still under development but in this approach the stability of thedroplet of organic solvent may be an issue', 'httpsdoi', 'org10', '1016j', 'jpha', '2019', '12', '00320951779 2019 xian jiaotong university', ' production and hosting by elsevier b', 'v', ' this is an open access article under the cc byncnd license httpcreativecommons', 'orglicensesbyncnd4', '0', '110w', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122fig', ' 1', ' classiﬁcation of liquid phase microextraction techniques', 'considering these limitations hollow ﬁber protected liquidphase microextraction hflpme was introduced in 1999 13', ' inthe ﬁrst paper hflpme was utilized for preconcentration andextraction of pharmaceuticals prior to electrophoretic identiﬁcation and determination', ' an aqueous extraction solvent was injectedinto the lumen of a porous polypropylene hollow ﬁber membranewhile the porous wall was impregnated by an organic supportedliquid membrane slm', ' as the extraction solvent acceptor phasewas not in direct contact with the sample solution the extractionsystem was stable and highly efﬁcient sample cleanup was achieved with this innovative strategy', ' hflpme can be utilized forquantitative analysis from very complex environmental and biological samples 14', 'a typical hflpme setup consists of a porous hollow ﬁbermembrane made of polypropylene polytetraﬂuoroethylene andpolyvinylidene ﬂuoride which is impregnated with an organicsolvent', ' the solvent is immobilized in the pores in the wall of thehollow ﬁber membrane and serves as supported liquid membraneslm 15', ' the acceptor phase can be either an aqueous solution oran organic solvent', ' due to this ﬂexibility hflpme is compatiblewith most analytical instruments for chromatography electrophoresis molecular and atomic spectrometry and electrochemistry', ' the current review discusses recent applications of hfbasedmicroextraction for pharmaceutical and heavy metal applicationsand on their compatibility with different instrumental methods', '2', ' principles and possible modes of the hflpmein hfbased lpme methods the extraction phase is placed in thelumen of a porous hollow ﬁber', ' in such a way the acceptor phase isprotected by the slm', ' to perform hflpme a polypropylene hollow ﬁber membrane may ﬁrst be sonicated in acetone to removepolymer impurities 16', ' then the hollow ﬁber membrane is soakedin an impregnating solvent to ﬁll the pores of the hf membrane bycapillary forces and excess solvent may be removed by washingwith distilled water 17', ' after this step the lumen of the hollowﬁber is ﬁlled with the acceptor phase', ' as is thoroughly discussedbelow the acceptor phase can be the same organic solvent as theslm the twophase mode or can be an aqueous solution thethreephase mode', ' finally the hollow ﬁber is immersed in thesample solution and the analytes are extracted from the samplethrough the slm and into the acceptor phase 18', ' four differentarrangements for hflpme have been reported i', 'e', ' rod like ushaped hollowﬁber solvent bar and knotted hollowﬁber', 'considering the physicochemical characteristics of the desiredanalytes and levels of complexity of the sample hflpme can beperformed in a two or threephase mode', '2', '1', ' twophase hflpmein twophase hflpme the pores in the wall of the hollow ﬁberand the lumen are ﬁlled with an organic solvent which is immiscible with the aqueous sample solution', ' solvents like 1octanol anddihexyl ether are commonly used 19', ' twophase hflpme isapplied for extraction and preconcentration of analytes with lowpolarity such as polycyclic aromatic hydrocarbons pahs', ' since theanalytes are extracted into an organic solvent twophase lpme iscompatible with gas chromatography', ' fig', ' 2 illustrates the principleof twophase hflpme', ' according to this the slm and the organicacceptor phase are the same in twophase hflpme', '2', '2', ' threephase hflpmein threephase lpme the pores in the wall of the hollow ﬁberare ﬁlled with an organic solvent immiscible with water while thelumen is ﬁlled with aqueous solution acceptor solution', ' 1octanoland dihexylether are common solvents 20', ' the mechanism ofextraction is based on ph adjustment of the sample solution andthe aqueous acceptor phase', ' for instance extraction of acidiccompounds is achieved by acidiﬁcation of the sample to suppressionization of the target analytes', ' this results in successful transferof analytes towards the acceptor phase through the organic slm', 'ph of the aqueous acceptor solution should be adjusted to a phvalue 2e3 units above pka of the analyte', 'carrier mediated threephase hflpme was introduced where ahydrophobic carrier was dissolved in the organic slm before theimpregnation of the hf pores 21', ' the applied carrier is an organiccompound capable of ionpairing with analytes of interest', ' henceat the contact region between the sample solution and the slm thedesired ionpair complexes are formed leading to successfulextraction of target analytes', ' at the contact region between theslm and the aqueous acceptor phase the analyte is exchanged withw', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122111fig', ' 2', ' a schematic mechanism of the twophase hflpme', 'a suitable inorganic counter ion dissolved in the acceptor solutionand is released into the acceptor solution', 'as mentioned threephase hflpme can be applied for ionizable compounds acids and bases', ' twophase hflpme offers highpfs and extraction efﬁciencies for nonpolar analytes', ' howeverbecause the slm and the acceptor phase are the same organicsolvent there is no phase boundary', ' therefore cleanup is limited', 'interestingly ghambarian et al', ' introduced a variant where ndodecane was used as the organic slm while organic solvents likemethanol ethanol or acetonitrile which are all immiscible with ndodecane were used as acceptor phase 22', ' this strategy providedimproved sample cleanup while extraction efﬁciency was notsacriﬁced', ' fig', ' 3 illustrates the principles of threephase hflpme', 'hflpme can be carried out through static dynamic and evenfully automated strategies', ' one of the most interesting approachesfor dynamic hflpme was introduced by esraﬁli et al', ' called ttextraction 23', ' between two t connectors a stainlesssteel tubewas mounted housing the hollow ﬁber membrane', ' the samplesolution was pumped into the ttextractor through the two tconnectors while the acceptor phase was injected into the hollowﬁber membrane via a syringe pump', ' this conﬁguration was capableof carrying out twophase hflpme', ' fig', ' 4 illustrates this innovative approach with all the details', ' in another strategy offered by thesame research group a fully automated hflpme with capabilityfor two and threephase hflpme procedures was developed', ' inthis setup a syringe pump was used for washing ﬁlling andejection of different solvents', ' four containers were used forwashing solvent slm extraction solvent and elution solvent', ' theextraction system was successfully connected with liquid chromatography', ' fig', ' 5 shows the graphical design of this hflpmeinstrument 24', '2', '3', ' electromembrane extractionin hflpme mass transfer is by passive diffusion and this resultsin relatively slow extraction kinetics', ' alternatively ionizable compounds can be extracted efﬁciently and with outstanding samplecleanup by electromembrane extraction eme 25', ' the principlew', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122of eme is similar to that of hflpme', ' however in eme the analytesare extracted selectively in their charged form under the inﬂuenceof an electrical ﬁeld', ' thus mass transfer is by electrokineticmigration across the slm and 2nitrophenyl octyl ether npoe isoften used as slm', ' the setup for eme is very similar to threephasehflpme but in eme two electrodes usually platinum wires areutilized', ' one electrode is placed in the acceptor phase into thehollow ﬁber lumen while the second electrode is inserted into thesample solution', ' fig', ' 6 shows the principle of eme', 'for extraction of basic analytes the cathode  is placed insidethe acceptor phase while for acidic analytes the direction of theelectrical ﬁeld is reversed 18', ' after extraction the acceptor phaseis collected with a microsyringe and injected into an analyticalinstrument for quantitative analysis', ' due to the electrical ﬁeldacross the slm bubble formation joule heating and even punctuation of slm may occur in eme systems operated under nonoptimal conditions', ' these phenomena occur in longer extractiontimes as a result of excessive migration of ions across slm', ' alsowhen the electrical ﬁeld is applied electrical double layers andlocal ph gradients are formed in the interfaces between the slmand the aqueous solutions on both side', ' these may impact the masstransfer', ' to reduce the impact of these phenomena application ofconstant direct electrical current and application of pulsed voltagehave been reported 26', ' although the utilization of a stabilized andconstant direct current improved the efﬁciency and stability ofeme this approach is still not common in eme publications', ' pulsedelectromembrane extraction peme was introduced as a strategyto enhance the efﬁciency of eme using a simple and inexpensiveextraction setup 27', ' pulsed voltage was found to improveextraction efﬁciency and system stability', '3', ' operational parameters of hflpme and emethe type of hollowﬁber membrane type of extraction solventph of donor and acceptor phases extraction time stirring rate saltaddition and temperature are important parameters in hflpmeand eme', ' applied voltage and electrode material thickness anddistance are additional parameters affecting eme performance', 'w', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122113fig', ' 6', ' a schematic mechanism for electromembrane extraction', '3', '1', ' hollowﬁber membranethe porous wall of the hollowﬁber serves as support for theslm', ' the slm solvent should be of low polarity and immisciblewith water', ' for immobilization of such lowpolarity solvents thehollowﬁber should be of hydrophobic material 28', ' in most casespolypropylene hollowﬁber membranes have been used', ' suchhollowﬁbers are commercially available at a low price', ' thereforeeach hollowﬁber membrane is used only for a single extractionand is then discarded', ' alternatively polyvinylidene diﬂuoridehollowﬁber membranes can be used 14', '3', '2', ' supported liquid membrane slmthe solvent selected for the slm plays a major role for the stability and the efﬁciency of the extraction system both in hflpmeand eme', ' first the solvent should be nonvolatile in order toavoid evaporation and solvents with boiling point exceeding200  c are recommended', ' second the solvent should be immisciblewith water in order to avoid leakage to the sample', ' usually solventswith water solubility less than 0', '5 mgml are recommended', ' thirdthe solvent should facilitate efﬁcient mass transfer of target analyte14', ' in hflpme high efﬁciency can often be obtained with a variety of organic solvents', ' common organic solvents for hflpmeinclude ndihexyl ether 1octanol dodecyl acetate and toluene', 'ionic liquids have also been used as slm solvent in hflpme 28', ' ineme the type of solvent used for the slm is much more critical29', ' this is due to the fact that analyte molecules are charged whenentering the organic slm and partition is voltage dependent', 'common organic solvents used in eme are 2enitrophenyloctylether npoe and 1octanol', '3', '3', ' sample and acceptor phsample and acceptor ph plays a major role both in hflpme andeme', ' in hflpme the analyte is extracted in neutral form into theslm while it is ionized in contact with the acceptor', ' therefore forextraction of basic analytes the sample should be alkaline whilethe acceptor should be acidic or neutral depending on analyte pkavalue', ' for hflpme of acidic analytes the ph gradient is reversedusing acidic conditions in the sample and alkaline or neutral conditions in the acceptor 3031', ' in eme the analytes are ionized inthe entire extraction system', ' thus for basic analytes both thesample and the acceptor are neutral or acidic', ' for acidic analyteseme is conducted with neutral or alkaline conditions in sample andacceptor 32', ' due to local ph effects 33 at the slm boundarylayers ph in the acceptor solution is critical in eme and for basicanalytes ph should be no less than three units above pka', ' inaddition ph may change in the sample and acceptor during emedue to electrolysis 34 and therefore buffers are recommended inboth sample and acceptor', '3', '4', ' extraction timeboth hflpme and eme are equilibrium techniques', ' this impliesthat extraction recovery increases rapidly versus time during initialextraction and after a certain period of time the systems enterequilibrium', ' thus from a theoretical point of view recovery isconstant from this point forward and extraction is terminated', 'equilibrium time is typically in the range 30e60 min for hflpmedepending on the chemical properties of the analytes and the geometry of the system 35', ' for eme equilibrium time is shorter dueto the electrokinetic mass transfer and ranges typically from 5 to15 min', ' in eme recoveries may drop during prolonged extractiondue to ph changes in sample and acceptor and due to instability ofthe slm 36', '3', '5', ' stirringagitationhflpme and eme are performed under stirring or agitationconditions', ' by such convection is induced in the sample and analyte mass transfer to the slm is facilitated', ' in addition stirring oragitation reduces the boundary layer thickness at the sampleslminterface and this is very important for efﬁcient mass transfer 31', 'the optimal stirring or agitation rate is geometry dependent and isnormally optimized during method development', ' typically stirring or agitation in the range 500e1000 rpm is used', ' at higherrates air bubbles are often formed and this can reduce extractionperformance 37', '3', '6', ' salt additionaddition of salt to the sample affects the efﬁciency of hflpmeand eme', ' in hflpme the addition of salt to the sample solution114w', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122often increases the extraction efﬁciency 3839', ' the increase inextraction efﬁciency is due to increased ionic strength in thesample which increases analyte partition into the organic slm', 'however negative effects of salt in the samples are also reported4041', ' this may be due to changes in the nernst diffusion ﬁlmcontrolling the diffusion rate of analytes into the acceptor phase4243', ' typical salt additions are 5e30 wv 44', ' in emeaddition of salt to the sample is normally not performed', ' for efﬁcient eme a low ion balance may be favorable under certain conditions 45e47', ' the ion balance is deﬁned as the ratio between thetotal amount of ions in the sample and the total amount of ions inthe acceptor phase', '3', '7', ' temperaturehflpme and eme are normally performed at room temperature', ' both extraction modes are affected by temperature', ' partitioncoefﬁcients decrease with the increase in temperature whilediffusion across the slm increases', ' temperatures up to 40 c havebeen used but above this temperature slms tend to be less stable3748', '3', '8', ' electrodes emeplatinum is normally used as inert electrode material in eme', 'the electrode thickness plays a key role in eme', ' the internaldiameter of the electrodes should be substantially less than theinner diameter of the hollow ﬁber in order not to displace acceptorphase', ' the distance between the electrodes is another importantparameter 49', '3', '9', ' applied voltage emegenerally the extraction efﬁciency in eme increases with theincreasing voltage up to a certain level', ' above this there is nofurther gain in extraction efﬁciency and mass transfer is no longerlimited by the voltage', ' voltages applied in eme normally rangefrom 5 to 300 v', ' voltages exceeding 300 v are not recommendeddue to instability of the extraction system and generation of gasbubbles electrolysis 37', 'microﬂuidic paperbased analytical device mpad for extractionof cr vi', ' the membrane was impregnated in a mixture of aliquat336 and 1octanol for 1 min', ' the acceptor phase was collected forcolorimetric analysis after eme and dpc reagent was added', ' forquantitative analysis a scanner was used and colored images wereanalyzed with rgb', ' the results were compared with icpaes andfound in good agreement 57', '4', '1', '2', ' uvevisible spectrophotometryuvevisible spectrophotometry has been commonly selected asinstrumental technique for quantitative analysis of heavy metalshighly conjugated organic compounds and biological macromolecules due to easy availability simplicity versatility speed accuracyprecision and costeffectiveness', ' however in complex samples theanalytes cannot be measured directly with a uvevisible spectrophotometer due to low concentration', ' therefore a sample preparation step is necessary to improve selectivity and sensitivity', 'atikarnsakul et al', ' presented an eme procedure for preconcentration and extraction of crvi', ' polypropylene hollow ﬁber membranewas impregnated with npoe and used for eme', ' for quantitativeanalysis a speciﬁc volume of acceptor phase was mixed with aspeciﬁc concentration of dpc and acidiﬁed with dilute h2so4', ' theresultant redviolet solution was analyzed with a ﬁber opticultravioletevisible spectrophotometer with a zﬂow cell at 544 nm61', 'onac et al', ' introduced a new approach to preconcentration andextraction of crvi', ' a polymer inclusion membrane was synthesized and used as slm for eme', ' the polymer inclusion membraneimpregnated with npoe contained calix 4arene', ' the eme processwas performed under constant current instead of constant voltageto control the extraction of charged species', ' the use of constantcurrent in eme provided high reproducibility and mechanical stability', ' the formation of metalcalix 4arene ion pair at themembraneaqueous phase interface enhanced the transport ofmetalcomplex ion through the membrane', ' bathwater of chromeplating industry was used as real sample for analysis to check theselectivity of calix 4arene towards crvi 62', ' table 1 summarizesexamples on research combining hollow ﬁber based extractiontechniques with uvevis spectrophotometry 61e65', '4', '2', ' pharmaceuticals4', ' instrumental techniques coupled with hflpme and eme4', '1', ' heavy metals determination4', '1', '1', ' atomic spectrometrycombinations of hollow ﬁber based techniques and atomicspectroscopic techniques have mainly been used for detection ofheavy metals in environmental clinical and biological samplespetroleum products pharmaceuticals and in food 50', ' the hollowﬁber based techniques coupled with atomic spectrometric techniques for preconcentration and determination of different heavymetals are summarized in table 1 51e60', ' hflpme has beencoupled to ﬂame atomic absorption spectroscopy faas andgraphite furnace atomic absorption spectrometry gfaas formetal analysis 51e55', ' in one example tahmasebi et al', ' introduced a new approach to the extraction of cr vi based on emecoupled with electrothermal atomic absorption spectrometryetaas', ' before using the hollow ﬁber membrane as slm polyaniline nanoparticles were coated on the surface to increase theselectivity for the extraction of crvi', ' the polyaniline reinforcedhollow ﬁber selectively extracted cr vi from real samples viaanion exchange', ' the surface area of the nanostructure coated polyaniline increased the preconcentration of the target analyte 56', 'in another example alahmad et al', ' introduced an hflpme4', '2', '1', ' high performance liquid chromatography hplcthreephase hflpme and eme are ideal for acidic and basicdrugs', ' in threephase hflpme the acceptor phase is an aqueoussolution and this can be injected directly into hplc systemswithout previous evaporation and reconstitution 30', ' for extraction of basic analytes in hflpme ph of donor phase must be keptalkaline to suppress the ionization and solubility of the analytewhereas ph for acceptor phase should be acidic', ' in case of acidicanalytes the ph gradient across the slm is reversed 3031', ' forextraction of basic analytes in eme ph of donor and acceptorphases are kept acidic to ionize the analytes', ' the anode is placed inthe donor phase while the cathode is placed in the acceptor phaseto facilitate the migration of analyte', ' in case of acidic analytes thedonor and acceptor phases are made alkaline and the direction ofthe electrical ﬁeld is reversed 3032', ' threephase systems providebetter degree of cleanup than two phase systems due to the factthat most water soluble components do not pass through the slm', 'khan et al', ' presented a new strategy for selective and simultaneous extraction of three drugs with different hydrophobicityproperty', ' the eme process was carried out in a microﬂuidic chipdevice', ' the microﬂuidic device consisted of three pmma plateshaving m shaped microchannels', ' the middle pmma plate provideda ﬂow path for sample solution and was in contact with twoeme electromembrane extraction hflpme hollow ﬁber liquid phase microextraction ieme intube electromembrane extraction cmhflpme carriermediated hollow ﬁber liquid phase microextraction dehp bis2ethylhexyl phosphate ctab nnncetyltrimethyl ammonium bromide apdc ammonium pyrroldinedithiocarbamate pani polyanniline ddtc diethyldithiocarbamate pan 12pyridylazo2naphthol npoe 2nitrophenyl octyl ether faas flame atomic absorption spectroscopy gfaas graphite furnace atomic absorption spectrometry etvicpoes electrothermal vaporization inductive couple plasma optical emission spectroscopy rgb icpaes red green blue analysis inductive couple plasma atomic emission spectroscopy', 'phthalate and nitrilebased organic solventshfdllme hollow ﬁber dispersive liquidliquid microextraction hflspme hollow ﬁber liquid solid phase microextraction peme pulsed electromembrane extraction cfeme continuousﬂow electromembrane extractionlpme liquid phase microextraction hfmmimspe hollow ﬁber membranemolecular imprintedmicro solid phase microextraction fmlpe flat membrane based liquid phase microextraction caehfeslpme cetylalcoholreinforced hollow ﬁber solid liquid phase microextraction miphfme molecular imprinted polymer hollow ﬁber microextraction dehpi bis2ethylhexyl phosphite tfpba 4triﬂuoromethylphenylboronic acid rgoreduced graphene oxide tbp tributyl phosphate dhe dihexyl ether pim polymer inclusion membrane topo trioctylphosphine oxide hplcuv high performance liquid chromatography with uv detector hplcms highperformance liquid chromatography with mass spectrometry hplcdadfld high performance liquid chromatography with diode array detector and ﬂuorescence detector hplcuvms high performance liquid chromatography with uv detector and mass spectrometry uhplcms ultra high performance liquid chromatography with mass spectrometry hplcdad high performance liquid chromatography with diode array detectorfluorometerrgb hplcuv fluorometer red green blue analysis high performance liquid chromatography with uv detector', 'emeeallme electromembrane extraction and electroassisted liquidliquid microextraction emspme electromembrane surrounded solid phase microextraction gemedllme gelelectromembrane exraction  dispersiveliquidliquid microextraction paeme parallel electromembrane extraction enb 1ethyl2nitrobenzene mwcnts multiwalled carbon nanotubes mil110cr chromium terephthalate metalorganic framework span80mono9z9octadecenoate cunps copper nanoparticles gcfid gas chromatography with ﬂame ionization detectorceuv capillary electrophoresis with uv detector cedad capillary electrophoresis with diode arraydetector ffsswv fast fourier transform stripping square wave voltammetry sfftccv stripping fast fourier transform continuous cyclic voltammetry dpv differential pulse voltammetry fftswv fast fourier transformsquare wave voltammetry', 'w', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122instrumental techniquew', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122different slms and acceptor phases', ' a stainless steel electrode wasembedded in the middle plate dedicated for the ﬂow of samplesolution', ' stainless steel electrodes were also embedded in the twopmma plates dedicated for the two acceptor phases', ' based ondifferent slms drugs of different hydrophobicity were extractedinto two acceptor phases and analyzed with hplcuv 66', 'nhidalgo et al', ' introduced a newin another example romabiopolymeric membrane for eme of nsaids and acidic compounds', 'the chitosan biopolymeric membrane was synthesized by mixingchitosan 60 ww and aliquat336 40 ww', ' the synthesizedmembrane was characterized with scanning electron microscopysem', ' the prepared membrane was impregnated with a suitableorganic solvent and used as slm in a homemade device', ' after emethe acceptor phase was analyzed with hplcdad for quantitativeanalysis 67', ' table 2 summarizes examples on research combininghollow ﬁber based extraction techniques with hplc 66e109', '4', '2', '2', ' gas chromatography gcgc has been coupled with twophase hflpme and eme foranalysis of neutral low and medium polar analytes', ' in two phasesystems the acceptor solution is the same organic solvent as usedfor impregnation of membrane', ' due to the fact that the acceptorphase is organic it can be injected directly in gc 109', ' an emespme technique were introduced by shamsayei et al', ' 110 for theextraction and determination of cyproheptadine and ketotifen', ' inthis work the surface of a stainless steel wire was electrochemicallydeposited with polypyrrole and manganese dioxide using cyclicvoltammetry', ' a segment of polypropylene membrane wasimpregnated with a suitable organic solvent and ﬁlled with wateras an acceptor phase', ' the prepared spme ﬁber electrochemicallyprepared stainless steel wire was introduced into the membraneand used as a cathode', ' the cathode comprising the slm and theacceptor solution was directed into donor solution', ' a platinumanode was directed into the sample solution', ' after eme the spmeﬁber was analyzed with gc 110', 'similarly tabani et al', ' presented a new approach to preconcentration and determination of basic drugs', ' an agarose geleme method was combined with dispersive liquideliquid microextraction dllme technique', ' for extraction of target analytes anagarosebased gel membrane was synthesized and used for eme', 'after eme acceptor phase was collected and mixed with 1 mmnaoh solution', ' dllme was carried out from this solution and theﬁnal organic extract was analyzed with gc 111', ' table 3 summarizes information on research combining hflpme and eme withgc 110e131', '4', '2', '3', ' capillary electrophoresis cece is another analytical instrument which has frequently beencoupled with threephase hflpme and eme 30', ' to avoid bandbroadening destacking the ionic strength of the acceptor phaseshould not exceed the ionic strength of the ce separation bufferk et al', ' presented a new semiautomatedmeme tech132', ' dvoranique for extraction of drugs coupled with ce', ' a three phasedisposable microextraction unit was constructed in which a freeliquid membrane was sandwiched between acceptor and donorphases', ' all liquid samples acceptor phase flm and donor phasewere handled with a programmable syringe pump', ' after eme theacceptor phase was collected by switching the syringe pump toinfusion mode', ' the collected acceptor phase was quantitativelyanalyzed with ce 113', ' et al', ' investigated the effect of membrane thickness onrysavathe extraction efﬁciency in eme 123', ' three polypropylenemembranes with different thickness were used as slms for emepreconcentration of basic drugs', ' in this experiment it wasconcluded that the transfer of analytes across the membrane is119inversely proportional to the membrane thickness', ' recent studiesof eme and hflpme coupled with ce are mentioned in table 3113e124', '4', '2', '4', ' voltammetryone of the most important and widely used electroanalyticaltechniques is voltammetry 133 and for quantiﬁcation of heavymetals anodic stripping voltammetry asv has been combinedwith hflpme', ' the major advantage of asv over other voltammetric techniques is the step of preconcentration onto the electrode surface 134', ' anodic stripping voltammetry has lowdetection limits high sensitivity and selectivity as compared toother electrochemical techniques', ' detection limits with anodicstripping voltammetry of heavy metals are in the ppm range 135', 'to the best of our knowledge 2017 to may2019 there is only oneresearch article on voltammetric instrumental technique forquantiﬁcation of heavy metals using hflpme or eme preconcentration', ' for pharmaceuticals several new approaches based onhollow ﬁber based techniques have been reported', ' in one examplehrdlicka et al', ' presented an hflpme method for extraction anddetermination of vanillylmandelic acid combined with dpv', ' in thisstudy a 20 mm polypropylene hollow ﬁber membrane was soakedin an organic solvent to impregnate the pores', ' the excess organicsolvent was removed by air with a syringe', ' the lumen of the ﬁberwas ﬁlled with acceptor phase and sealed in both ends', ' the prepared membrane was fully immersed in sample solution and stirred with a magnetic bar', ' after eme the acceptor phase wascollected and transferred to the surface of working electrode fordpv analysis 131', 'tahmasebi et al', ' reported a novel approach in eme for preconcentration and determination of propylthiouracil coupled withdpv', ' cunps were synthesized for selective extraction of propylthiouracil and coated on hollow ﬁber membrane', ' the coated cunpsincreased mass transfer and selectivity of propylthiouracil due tothe high selectivity of cunps toward thiol groupsulfhydryl compounds', ' the high afﬁnityselectivity of propylthiouracil towardscunps was explained by the hard and soft acidbase theory', ' it wasconcluded that nitrobenzene was the best choice for propylthiouracil extraction because alcoholic solvents such as 1octanol and2ethylhexanol dissolved cunps', ' it was pointed out that thisapproach was not applicable for acidic compounds 129', ' researchcombining hflpme and eme with voltammetry is summarized intable 3 125e131', '5', ' conclusions and looking into the futuresince 1999 a larger number of reports have been published onthe development of hflpme', ' these efforts have documented hflpme as a green sample preparation technique requiring only afew microliters of organic solvent per sample', ' hflpme enableshigh enrichment and excellent sample cleanup from biological andenvironmental samples', ' in the threephase mode hflpme provides aqueous extracts which are directly injectable in hplc', ' due tothe protection of the acceptor phase by the slm hflpme isamenable to highly complex samples such as plasma whole bloodurine saliva breast milk tap water surface water pond waterseawater and soil slurries', ' hflpme shows great potential forroutine applications but to enter this area commercial productsand automation are required', ' also generic methods have to bedeveloped to simplify method development', 'eme has been developed in parallel to hflpme but eme is lessmature', ' although eme provides the same advantages as hflpmethe electrical ﬁeld open for additional perspectives', ' thus theextraction is controlled by an external electrical ﬁeld and selectivity may be tuned by the direction and magnitude of the electrical120w', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122ﬁeld by the chemical composition of the slm and by ph in sampleand acceptor phase', 'both hflpme and eme are highly efﬁcient for extraction ofheavy metals and pharmaceuticals', ' the techniques are compatiblewith a broad spectrum of chromatographic spectroscopic andelectroanalytical techniques', ' future work should focus on automation and commercialization', ' in addition the future may seeresearch on the use of green solvents and slms modiﬁed withmetal nanoparticles mnps and carbon nanotubes cnts whichmay increase the extraction efﬁciency of targeted analytes', 'conﬂicts of interestthe authors declare that there are no conﬂicts of interest', 'acknowledgmentsthis work was supported by the higher education commissionof pakistan nrpu no', '20e3925rdnrpuhec2014 pakusscience and technology cooperation pakus no64pakushec201504 and pakistan science foundation joint research projectswith msrt iran no', ' psfmsrtenvkpawkum', '', '', '', '', '', '', '1 l', ' ramos critical overview of selected contemporary sample preparationtechniques j', ' chromatogr', ' a 1221 2012 84e98', '2 m', 'c', ' hennion solidphase extraction method development sorbents andcoupling with liquid chromatography j', ' chromatogr', ' a 856 1999 3e54', '3 y', ' saito m', ' imaizumi k', ' ban et al', ' development of miniaturized samplepreparation with ﬁbrous extraction media j', ' chromatogr', ' a 1025 200427e32', '4 c', 'l', ' arthur j', ' pawliszyn solid phase microextraction with thermal desorption using fused silica optical ﬁbers anal', ' chem', ' 62 1990 2145e2148', '5 m', 'a', ' jeannot f', 'f', ' cantwell solvent microextraction into a single drop anal', 'chem', ' 68 1996 2236e2240', '6 z', ' zhang j', ' pawliszyn headspace solidphase microextraction anal', ' chem', '65 1993 1843e1852', '7 r', ' eisert j', ' pawliszyn automated intube solidphase microextractioncoupled to highperformance liquid chromatography anal', ' chem', ' 69 19973140e3147', '8 i', ' bruheim x', ' liu j', ' pawliszyn thinﬁlm microextraction anal', ' chem', ' 752003 1002e1010', '9 g', ' shen h', 'k', ' lee headspace liquidphase microextraction of chlorobenzenesin soil with gas chromatographyelectron capture detection anal', ' chem', ' 752003 98e103', '10 h', ' xu z', ' ding l', ' lv et al', ' a novel dispersive liquideliquid microextractionbased on solidiﬁcation of ﬂoating organic droplet method for determinationof polycyclic aromatic hydrocarbons in aqueous samples anal', ' chim', ' acta636 2009 28e33', '11 m', ' rezaee y', ' assadi m', 'r', ' milani hosseini et al', ' determination of organiccompounds in water using dispersive liquideliquid microextractionj', ' chromatogr', ' a 1116 2006 1e9', '12 l', 'e', ' veraavila t', ' rojoportillo r', ' covarrubiasherrera et al', ' capabilitiesand limitations of dispersive liquideliquid microextraction with solidiﬁcation of ﬂoating organic drop for the extraction of organic pollutants fromwater samples anal', ' chim', ' acta 805 2013 60e69', '13 s', ' pedersenbjergaard k', 'e', ' rasmussen liquid liquid liquid microextraction for sample preparation of biological ﬂuids prior to capillaryelectrophoresis anal', ' chem', ' 71 1999 2650e2656', '14 a', 'm', 'a', ' alsharif g', 'h', ' tan y', 'm', ' choo et al', ' efﬁciency of hollow ﬁber liquidphase microextraction chromatography methods in the separation of organiccompounds a review j', ' chromatogr', ' sci', ' 55 2017 378e391', '15 m', ' ghambarian y', ' yamini a', ' esraﬁli developments in hollow ﬁber basedliquidphase microextraction principles and applications microchimi acta177 2012 271e294', '16 h', ' chen j', ' han y', ' wang et al', ' hollow ﬁber liquidphase microextraction ofcadmium ii using an ionic liquid as the extractant microchim acta 1812014 1455e1461', '17 j', ' abulhassani j', 'l', ' manzoori m', ' amjadi hollow ﬁber basedliquid phasemicroextraction using ionic liquid solvent for preconcentration of lead andnickel from environmental and biological samples prior to determination byelectrothermal atomic absorption spectrometry j', ' hazard mater', ' 176 2010481e486', '18 a', ' gjelstad s', ' pedersenbjergaard k', 'f', ' seip electromembrane extraction as arapid and selective miniaturized sample preparation technique for biologicalﬂuids bioanalysis 7 2015 2203e2209', '19 a', ' esraﬁli m', ' baharfar m', ' tajik et al', ' twophase hollow ﬁber liquidphasemicroextraction trac trends anal', ' chem', ' reference ed', ' 108 2018314e322', '20 k', ' folde bårdstu t', 's', ' ho k', 'e', ' rasmussen et al', ' supported liquid membranesin hollow ﬁber liquidphase microextraction lpmeepractical considerations in the threephase mode j', ' sep', ' sci', ' 30 2007 1364e1370', '21 s', ' shariati y', ' yamini a', ' esraﬁli carrier mediated hollow ﬁber liquid phasemicroextraction combined with hplceuv for preconcentration and determination of some tetracycline antibiotics j', ' chromatogr', ' b 877 2009393e400', '22 m', ' ghambarian y', ' yamini a', ' esraﬁli threephase hollow ﬁber microextraction based on two immiscible organic solvents for determination oftricyclic antidepressant drugs comparison with conventional threephasehollow ﬁber microextraction j', ' chromatogr', ' a 1222 2012 5e12', '23 a', ' esraﬁli y', ' yamini m', ' ghambarian et al', ' a novel approach to automationof dynamic hollow ﬁber liquidphase microextraction j', ' sep', ' sci', ' 34 2011957e964', '24 a', ' esraﬁli y', ' yamini m', ' ghambarian et al', ' automated preconcentration andanalysis of organic compounds by online hollow ﬁber liquidphasemicroextractionehigh performance liquid chromatography j', ' chromatogr', 'a 1262 2012 27e33', '25 s', ' pedersenbjergaard k', 'e', ' rasmussen electrokinetic migration across artiﬁcial liquid membranes new concept for rapid sample preparation of biological ﬂuids j', ' chromatogr', ' a 1109 2006 183e190', ' p', ' kub  p', ' bo26 a', ' slampovaancek electromembrane extraction using stabilized constant d', 'c', ' electric currentda simple tool for improvement ofextraction performance j', ' chromatogr', ' a 1234 2012 32e37', '27 m', ' rezazadeh y', ' yamini s', ' seidi et al', ' pulsed electromembrane extractiona new concept of electrically enhanced extraction j', ' chromatogr', ' a 12622012 214e218', '28 v', ' shariﬁ a', ' abbasi a', ' nosrati application of hollow ﬁber liquid phasemicroextraction and dispersive liquideliquid microextraction techniques inanalytical toxicology j', ' food drug anal', ' 24 2016 264e276', '29 v', ' krishna marothu m', ' gorrepati r', ' vusa electromembrane extractiondanovel extraction technique for pharmaceutical chemical clinical and environmental analysis j', ' chromatogr', ' sci', ' 51 2013 619e631', '30 j', ' płotkawasylka k', ' owczarek j', ' namiesnik modern solutions in the ﬁeld ofmicroextraction using liquid as a medium of extraction trac trends anal', 'chem', ' reference ed', ' 85 2016 46e64', '31 k', 'e', ' rasmussen s', ' pedersenbjergaard developments in hollow ﬁbrebasedliquidphase microextraction trac trends anal', ' chem', ' reference ed', ' 232004 1e10', '32 m', ' rezazadeh y', ' yamini s', ' seidi electromembrane extraction of traceamounts of naltrexone and nalmefene from untreated biological ﬂuidsj', ' chromatogr', ' b 879 2011 1143e1148', '33 l', ' vårdal e', 'l', ' øiestad a', ' gjelstad et al', ' electromembrane extraction ofsubstances with weakly basic properties a fundamental study with benzodiazepines bioanalysis 10 2018 769e781', '34 c', ' huang z', ' chen a', ' gjelstad et al', ' electromembrane extraction tractrends anal', ' chem', ' reference ed', ' 95 2017 47e56', '35 e', ' psillakis n', ' kalogerakis developments in liquidphase microextractiontrac trends anal', ' chem', ' reference ed', ' 22 2003 565e574', '36 c', ' huang k', 'f', ' seip a', ' gjelstad et al', ' electromembrane extraction forpharmaceutical and biomedical analysisequo vadis j', ' pharm', ' biomed', ' anal', '113 2015 97e107', '37 v', ' krishna marothu m', ' gorrepati r', ' vusa electromembrane extractiondanovel extraction technique for pharmaceutical chemical clinical and environmental analysis j', ' chromatogr', ' sci', ' 51 2013 619e631', '38 m', ' ghambarian y', ' yamini a', ' esraﬁli threephase hollow ﬁber liquidphasemicroextraction based on two immiscible organic solvents for determinationof tramadol in urine and plasma samples j', ' pharm', ' biomed', ' anal', ' 56 20111041e1045', ' pez r', ' fern39 m', 'r', ' payan m', 'a', 'b', 'loandeztorres et al', ' hollow ﬁberbasedliquid phase microextraction hflpme as a new approach for the hplcdetermination of ﬂuoroquinolones in biological and environmental matricesj', ' pharm', ' biomed', ' anal', ' 55 2011 332e341', '40 m', 'r', ' hadjmohammadi m', ' soltani use of hollow ﬁber liquid phase microextraction and hplc for extraction and determination of apigenin in humanurine after consumption of satureja sahendica bornm j', ' chromatogr', ' b 9002012 85e88', '41 k', 'm', ' al azzam a', ' makahleah b', ' saad et al', ' hollow ﬁber liquidphasemicroextraction for the determination of trace amounts of rosiglitazoneantidiabetic drug in biological ﬂuids using capillary electrophoresis andhigh performance liquid chromatographic methods j', ' chromatogr', ' a 12172010 3654e3659', '42 v', ' shariﬁ a', ' abbasi a', ' nosrati application of hollow ﬁber liquid phasemicroextraction and dispersive liquideliquid microextraction techniques inanalytical toxicology j', ' food drug anal', ' 24 2016 264e276', '43 j', ' xiong b', ' hu comparison of hollow ﬁber liquid phase microextraction anddispersive liquideliquid microextraction for the determination of organosulfur pesticides in environmental and beverage samples by gas chromatography with ﬂame photometric detection j', ' chromatogr', ' a 1193 20087e18', '44 a', ' saleh y', ' yamini m', ' faraji et al', ' hollow ﬁber liquid phase microextractionfollowed by high performance liquid chromatography for determination ofw', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122ultratrace levels of se iv after derivatization in urine plasma and naturalwater samples j', ' chromatogr', ' b 877 2009 1758e1764', 's', ' seidi y', ' yamini a', ' heydari et al', ' determination of thebaine in watersamples biological ﬂuids poppy capsule and narcotic drugs using electromembrane extraction followed by highperformance liquid chromatographyanalysis anal', ' chim', ' acta 701 2011 181e188', 't', 'm', ' middelthonbruer a', ' gjelstad k', 'e', ' rasmussen et al', ' parametersaffecting electro membrane extraction of basic drugs j', ' sep', ' sci', ' 31 2008753e759', 'm', ' balchen t', 'g', ' halvorsen l', ' reubsaet et al', ' rapid isolation of angiotensinpeptides from plasma by electromembrane extraction j', ' chromatogr', ' a 12162009 6900e6905', 'cek electric ﬁeldenhanced transport acrossphase boundaries and membranes and its potential use in sample pretreatment for bioanalysis electrophoresis 31 2010 768e785', 'y', ' yamini s', ' seidi m', ' rezazadeh electrical ﬁeldinduced extraction andseparation techniques promising trends in analytical chemistryea reviewanal', ' chim', ' acta 814 2014 1e22', 'j', ' sneddon determination of heavy metals in food by atomic spectroscopyanal endocr disrup comp food 2011 289', 's', ' bahar z', ' es haghi a', ' nezhadali et al', ' an innovative method for analysisof pb ii in rice milk and water samples based on tio2 reinforced caprylicacid hollow ﬁber solidliquid phase microextraction food chem', ' 221 20171904e1910', 'c', ' zeng y', ' yan j', ' tang et al', ' speciation of arsenic iii and arsenic v basedon triton x100 hollow ﬁber liquid phase microextraction coupled withﬂame atomic absorption spectrometry spectrosc', ' lett', ' 50 2017 220e226', 'l', ' boutorabi m', ' rajabi m', ' bazregar et al', ' selective determination of chromium vi ions using intube electromembrane extraction followed byﬂame atomic absorption spectrometry microchem', ' j', ' 132 2017 378e384', 's', ' salari a', ' bahrami f', ' ghamari et al', ' multivariate optimization of thehollow ﬁberbased liquid phase microextraction of lead in human blood andurine samples using graphite furnace atomic absorption spectrometrychem', ' pap', ' 72 2018 1945e1952', 'm', 'a', ' kamyabi a', ' aghaei a simple and selective approach for determinationof trace hg ii using electromembrane extraction followed by graphitefurnace atomic absorption spectrometry spectrochem acta b 128 201717e21', 'z', ' tahmasebi s', 's', 'h', ' davarani h', ' ebrahimzadeh et al', ' ultratrace determination of cr vi ions in real water samples after electromembrane extractionthrough novel nanostructured polyaniline reinforced hollow ﬁbers followedby electrothermal atomic absorption spectrometry microchem', ' j', ' 143 2018212e219', 'w', ' alahmad n', ' tungkijanansin t', ' kaneta et al', ' a colorimetric paperbasedanalytical device coupled with hollow ﬁber membrane liquid phase microextraction hflpme for highly sensitive detection of hexavalent chromiumin water samples talanta 190 2018 78e84', 'l', ' alavi s', ' seidi a', ' jabbari et al', ' deep eutectic liquid organic salt as a newsolvent for carriermediated hollow ﬁber liquid phase microextraction oflead from whole blood followed by electrothermal atomic absorption spectrometry new j', ' chem', ' 41 2017 7038e7044', 's', ' nojavan t', ' rahmani s', ' mansouri selective determination of chromiumvi in industrial wastewater samples by microelectromembrane extractioncombined with electrothermal atomic absorption spectrometry water airsoil pollut 229 2018 89', 'a', ' thongsaw r', ' sananmuang y', ' udnan et al', ' speciation of mercury in waterand freshwater ﬁsh samples using twostep hollow ﬁber liquid phasemicroextraction with electrothermal atomic absorption spectrometryspectrochem acta b 152 2019 102e108', 'u', ' atikarnsakul p', ' varanusupakul w', ' alahmad isolation of chromium vifrom aqueous solution by electromembrane extraction anal', ' lett', ' 51 2018983e997', 'c', ' onac a', ' kaya i', ' sener et al', ' an electromembrane extraction with polymeric membrane under constant current for the recovery of cr vi fromindustrial water j', ' electrochem', ' soc', ' 165 2018 e76ee80', 'a', ' fashi m', 'r', ' yaftian a', ' zamani electromembrane extractionpreconcentration followed by microvolume uvevis spectrophotometricdetermination of mercury in water and ﬁsh samples food chem', ' 221 2017714e720', 'm', ' khajeh m', ' dahmardeh m', ' bohlooli et al', ' determination of gold in watersamples using electromembrane extraction j', ' dispersion sci', ' technol', ' 392018 311e315', 'a', ' fashi m', 'r', ' yaftian a', ' zamani electromembranemicroextraction of bismuth in pharmaceutical and human plasma samples optimization usingresponse surface methodology microchem', ' j', ' 130 2017 71e78', 'w', 'a', ' khan y', ' yamini m', ' baharfar et al', ' a new microﬂuidicchip device forselective and simultaneous extraction of drugs with various properties newj', ' chem', ' 43 2019 9689e9695', 'nhidalgo g', ' lo pezperez m', 'j', ' martínvalero et al', ' chitosan tailorc', ' romamade membranes as biopolymeric support for electromembrane extractiontalanta 199 2019 290e295', 'ndez l', ' vårdal l', ' vidal et al', ' complexationmediated electroe', ' fernamembrane extraction of highly polar basic drugsda fundamental study withcatecholamines in urine as model system anal', ' bioanal', ' chem', ' 409 20174215e4223', '12169 h', ' xu h', 'y', ' mi m', 'm', ' guan et al', ' residue analysis of tetracyclines in milk byhplc coupled with hollow ﬁber membranesbased dynamic liquidliquidmicroextraction food chem', ' 232 2017 198e202', '70 f', ' ghamari a', ' bahrami y', ' yamini et al', ' hollowﬁber liquidphase microextraction based on carriermediated transport for determination of urinarymethyl hippuric acids toxicol', ' environ', ' chem', ' 99 2017 760e771', '71 a', ' bahrami f', ' ghamari y', ' yamini et al', ' hollow ﬁber supported liquidmembrane extraction combined with hplcuv for simultaneous preconcentration and determination of urinary hippuric acid and mandelic acidmembranes 7 2017 8', '72 y', ' zhang w', ' guo z', ' yue et al', ' rapid determination of 54 pharmaceuticaland personal care products in ﬁsh samples using microwaveassistedextractiondhollowﬁberdliquidsolidphasemicroextractionj', ' chromatogr', ' b 1051 2017 41e53', '73 a', ' fashi f', ' khanban m', 'r', ' yaftian et al', ' the cooperative effect of reducedgraphene oxide and triton x114 on the electromembrane microextractionefﬁciency of pramipexole as a model analyte in urine samples talanta 1622017 210e217', '74 m', 's', ' restan h', ' jensen x', ' shen et al', ' comprehensive study of buffer systemsand local ph effects in electromembrane extraction anal', ' chim', ' acta 9842017 116e123', '75 m', ' karami y', ' yamini y', 'a', ' asl et al', ' onchip pulsed electromembraneextraction as a new concept for analysis of biological ﬂuids in a small devicej', ' chromatogr', ' a 1527 2017 1e9', '76 h', ' tabani s', ' asadi s', ' nojavan et al', ' introduction of agarose gel as a greenmembrane in electromembrane extraction an efﬁcient procedure for theextraction of basic drugs with a wide range of polarities j', ' chromatogr', ' a1497 2017 47e55', '77 c', ' romanhidalgo m', 'j', ' martínvalero r', ' fernandeztorres et al', ' newnanostructured support for carriermediated electromembrane extraction ofhigh polar compounds talanta 162 2017 32e37', '78 m', ' baharfar y', ' yamini s', ' seidi et al', ' quantitative analysis of clonidine andephedrine by a microﬂuidic system onchip electromembrane extractionfollowed by high performance liquid chromatography j', ' chromatogr', ' b 10682017 313e321', '79 n', 's', 'm', ' hanapi m', 'm', ' sanagi a', 'k', ' ismail et al', ' ionic liquidimpregnatedagarose ﬁlm twophase microelectrodriven membrane extraction ilafmeme for the analysis of antidepressants in water samples j', ' chromatogr', ' b1046 2017 73e80', '80 a', ' atarodi m', ' chamsaz a', 'z', ' moghaddam et al', ' introduction of fullerene as anew carrier in electromembrane extraction for the determination ofibuprofen and sodium diclofenac as model acidic drugs in real urine sampleschromatographia 80 2017 881e890', '81 n', 's', ' mohamad hanapi m', 'm', ' sanagi a', 'k', ' ismail et al', ' rapid determination ofnonsteroidal antiinﬂammatory drugs in aquatic matrices by twophasemicroelectrodriven membrane extraction combined with liquid chromatography j', ' chromatogr', ' sci', ' 56 2017 166e176', '82 s', ' nojavan m', ' sirani s', ' asadi investigation of the continuous ﬂow of thesample solution on the performance of electromembrane extraction comparison with conventional procedure j', ' sep', ' sci', ' 40 2017 3889e3897', ' izvalencia j', 'm', ' jurado et al', ' hollow ﬁber liquid83 v', ' salvatierrastamp r', ' munphase microextraction combined with liquid chromatographytandem massspectrometry for the analysis of emerging contaminants in water samplesmicrochem', ' j', ' 140 2018 87e95', '84 c', ' worawit d', 'j', ' cocovisolberg p', ' varanusupakul et al', ' inline carbonnanoﬁber reinforced hollow ﬁbermediated liquid phase microextractionusing a 3d printed extraction platform as a front end to liquid chromatography for automatic sample preparation and analysis a proof of conceptstudy talanta 185 2018 611e619', '85 m', ' rajabi n', ' ghassab m', ' hemmati et al', ' highly effective and safe intermediate based on deep eutectic medium for carrier lessthree phase hollowﬁber microextraction of antiarrhythmic agents in complex matricesj', ' chromatogr', ' b 1104 2019 196e204', '86 r', 'h', ' cristina m', 'v', 'm', ' jesús f', 't', ' rut et al', ' use of polymer inclusionmembranes pims as support for electromembrane extraction of nonsteroidal antiinﬂammatory drugs and highly polar acidic drugs talanta179 2018 601e607', '87 s', ' asadi h', ' tabani s', ' nojavan application of polyacrylamide gel as a newmembrane in electromembrane extraction for the quantiﬁcation of basicdrugs in breast milk and wastewater samples j', ' pharm', ' biomed', ' anal', ' 1512018 178e185', '88 s', ' yaripour a', ' mohammadi i', ' esfanjani et al', ' quantitation of zolpidem inbiological ﬂuids by electrodriven microextraction combined with hplcuvanalysis excli journal 17 2018 349', '89 j', 'm', ' kim s', 'w', ' myung determination of nonsteroidal antiinﬂammatorydrugs in urine by hplceuvvis analysis coupled with electromembraneextraction bull', ' korean chem', ' soc', ' 39 2018 335e340', '90 s', ' yaripour m', ' zaheri a', ' mohammadi an electromembrane extractionehplcuv analysis for the determination of valproic acid in humanplasma j', ' chin', ' chem', ' soc', ' 65 2018 989e994', '91 h', 'r', ' moazami s', 's', 'h', ' davarani m', ' abrari et al', ' electromembrane extractionusing a roundheaded platinum wire as the inner electrode a simple andpractical way to enhance the performance of extraction chromatographia 812018 1023e1033', '92 c', ' huang x', ' shen a', ' gjelstad et al', ' investigation of alternative supportedw', 'a', ' khan et al', '  journal of pharmaceutical analysis 10 2020 109e122liquid membranes in electromembrane extraction of basic drugs from human plasma j', ' membr', ' sci', ' 548 2018 176e183', 'm', 'a', ' ramos payan e', ' santigosa r', ' fernandez torres et al', ' a new microchipdesign', ' a versatile combination of electromembrane extraction and liquidphase microextraction in a single chip device anal', ' chem', ' 90 201810417e10424', 'm', 'r', ' saadat m', ' qomi s', ' emadzadeh et al', ' microextraction and determination of diclofenac in biological samples using hollow ﬁber liquid phasemicroextraction technique coupled with hplcuv j appli chemi resear 122018 16e25', 'a', ' nazaripour y', ' yamini h', ' bagheri extraction and determination of traceamounts of three anticancer pharmaceuticals in urine by threephase hollowﬁber liquidphase microextraction based on two immiscible organic solventsfollowed by highperformance liquid chromatography j', ' sep', ' sci', ' 41 20183113e3120', 'r', 'p', ' horta b', ' do amaral p', 'g', ' peraltazamora et al', ' evaluation of a hollowﬁber liquidphase microextraction technique for the simultaneous determination of ppi drugs in human plasma by lcdad j', ' chromatogr', ' sci', ' 562018 564e573', 'n', 'n', ' alhashimi a', 'i', ' awwad a', 'n', ' alhashimi et al', ' functionalized multiwalled carbon nanotubesreinforced hollow ﬁber solidliquid phase microextraction and hplcdad for determination of phenazopyridine in urinecurr', ' pharmaceut', ' anal', ' 15 2019 447e455', 'l', ' yang y', ' shi j', ' li et al', ' in situ derivatization and hollowﬁber liquidphasemicroextraction to determine sulfonamides in water using uhplc withﬂuorescence detection j', ' sep', ' sci', ' 41 2018 1651e1662', 'm', ' díazalvareza', ' martínesteban hollow ﬁber membraneprotectedmolecularly imprinted microspheres for micro solidphase extraction andcleanup of thiabendazolein citrus samplesj', ' chromatogr', ' a 1531 201839e45', 's', 's', ' hosseiny davarani a', ' pourahadi p', ' ghasemzadeh quantiﬁcation ofcontrolled release leuprolide and triptorelin in rabbit plasma using electromembrane extraction coupled with hplceuv electrophoresis 40 20191074e1081', 'n m', ' callejonmochon et al', ' effect ofn', ' arandamerino m', ' ramospayacounterions on electromembrane extraction of nonsteroidal antiinﬂammatory drugs j', ' electroanal', ' chem', ' 840 2019 255e262', 's', 's', ' nasrollahi s', 's', 'h', ' davarani h', 'r', ' moazami impedometric investigation ofsalt effects on electromembrane extraction practical hints for ph adjustment electrochim', ' acta 296 2019 355e363', 'a', ' rahimi s', ' nojavan electromembrane extraction of verapamil and riluzolefrom urine and wastewater samples using a mixture of organic solvents as asupported liquid membrane study on electric current variations j', ' sep', ' sci', '42 2019 566e573', 'r', ' zhu y', ' dong x', ' cai et al', ' determination of barbiturates in biologicalspecimens by flat membranebased liquidphase microextraction and liquidchromatographymass spectrometry molecules 24 2019 1494', 's', ' seidi m', 'h', ' ranjbar m', ' baharfar et al', ' a promising design of microﬂuidicelectromembrane extraction coupled with sensitive colorimetric detectionfor colorless compounds based on quantum dots ﬂuorescence talanta 1942019 298e307', 'f', ' zarghampour y', ' yamini m', ' baharfar et al', ' simultaneous extraction ofacidic and basic drugs via onchip electromembrane extraction using asinglecompartment microﬂuidic device analyst 144 2019 1159e1166', 'n', 'n', ' alhashimi r', 'o', ' shahin a', 'n', ' alhashimi et al', ' cetylalcoholreinforced hollow ﬁber solidliquidphase microextraction and hplcedadanalysis of ezetimibe and simvastatin in human plasma and urine biomed', 'chromatogr', ' 33 2019 e4410', 'f', ' barahona b', ' albero j', 'l', ' tadeo et al', ' molecularly imprinted polymerhollow ﬁber microextraction of hydrophilic ﬂuoroquinolone antibiotics inenvironmental waters and urine samples j', ' chromatogr', ' a 1587 201942e49', 's', ' seidi l', ' alavi a', ' jabbari et al', ' threephase carriermediated hollow ﬁbermicroextraction based on deep eutectic solvent followed by hplceuv fordetermination of raloxifene and ethinylestradiol in pharmaceutical wastewater treatment plants j', ' iran', ' chem', ' soc', ' 16 2019 1007e1018', 'm', ' shamsayei y', ' yamini h', ' asiabi et al', ' electromembrane surroundedsolidphase microextraction using a stainlesssteel wire coated with ananocomposite composed of polypyrrole and manganese dioxide microchim acta 184 2017 2697e2705', 'h', ' tabani a', ' shokri s', ' tizro et al', ' evaluation of dispersive liquideliquidmicroextractionbycouplingwithgreenbasedagarosegelelectromembrane extraction an efﬁcient method to the tandem extractionof basic drugs from biological ﬂuids talanta 199 2019 329e335', 's', ' nojavan h', ' shaghaghi t', ' rahmani et al', ' combination of electromembrane extraction and electroassisted liquidliquid microextraction atandem sample preparation method j', ' chromatogr', ' a 1563 2018 20e27', 'k k', 'f', ' seip s', ' pedersenbjergaard et al', ' semiautomated setup form', ' dvoraexhaustive microelectromembrane extractions of basic drugs frombiological ﬂuids anal', ' chim', ' acta 1005 2018 34e42', 'n  inline coupling of supported liquid membrane114 p', ' pantuckova p', ' kubaextraction to capillary electrophoresis for simultaneous analysis of basic andacidic drugs in urine j', ' chromatogr', ' a 1519 2017 137e144', '115 m', ' forough k', ' farhadi a', ' eyshi et al', ' rapid ionic liquidsupported nanohybrid composite reinforced hollowﬁber electromembrane extraction followed by ﬁeldampliﬁed sample injectioncapillary electrophoresis aneffective approach for extraction and quantiﬁcation of imatinib mesylate inhuman plasma j', ' chromatogr', ' a 1516 2017 21e34', '116 a', ' slampova p', ' kuban direct analysis of free aqueous and organic operational solutions as a tool for understanding fundamental principles of electromembrane extraction anal', ' chem', ' 89 2017 12960e12967', '117 n', ' drouin j', 'f', 'o', ' mandscheff s', ' rudaz et al', ' development of a newextraction device based on parallelelectromembrane extraction anal', 'chem', ' 89 2017 6346e6350', '118 a', 'r', ' fakhari s', ' asadi h', 'm', ' kosalar et al', ' metaleorganic frameworkenhanced electromembrane extractionea conceptual study using basicdrugs as model substances ana methods 9 2017 5646e5652', '119 z', ' aladaghlo a', 'r', ' fakhari k', 's', ' hasheminasab carrier assisted electromembrane extraction based on nonionic lipophilic surfactants for thedetermination of basic drugs in urine samples ana methods 9 20175659e5667', '120 m', ' forough k', ' farhadi r', ' molaei et al', ' capillary electrophoresis with onlinestacking in combination with agnps mcm41 reinforced hollow ﬁbersolidliquid phase microextraction for quantitative analysis of capecitabineand its main metabolite 5fluorouracil in plasma samples isolated fromcancer patients j', ' chromatogr', ' b 1040 2017 22e37', '121 a', 'r', ' fakhari h', ' mohammadi kosalar s', ' asadi et al', ' surfactantassistedelectromembrane extraction combined with cyclodextrinmodiﬁed capillaryelectrophoresis for the separation and quantiﬁcation of tranylcypromineenantiomers in biological samples j', ' sep', ' sci', ' 41 2018 475e482', '  twophase microelectromembrane extraction across122 a', ' slampovafree liquid membrane for determination of acidic drugs in complex samplesanal', ' chim', ' acta 1048 2019 58e65', 'k p', ' kub  the effect of membrane thickness on sup123 l', ' rysava m', ' dvoraan membraneported liquidextractions inline coupled to capillary electrophoresis for analyses of complex samples j', ' chromatogr', ' a 1596 2019226e232', '124 c', ' romanhidalgo e', ' santigosamurillo m', ' ramospayan et al', ' onchipelectromembrane extraction of acidic drugs electrophoresis 2019', '125 z', ' moﬁdi p', ' norouzi s', ' seidi et al', ' efﬁcient design for in situ determinationof amlodipine in whole blood samples using fast fourier transform strippingsquare wave voltammetry after preconcentration by electromembraneextraction new j', ' chem', ' 41 2017 13567e13575', '126 z', ' moﬁdi p', ' norouzi s', ' seidi et al', ' determination of diclofenac usingelectromembrane extraction coupled with stripping fft continuous cyclicvoltammetry anal', ' chim', ' acta 972 2017 38e45', '127 b', ' hatamluyi z', ' es haghi a layerbylayer sensing architecture based ondendrimer and ionic liquid supported reduced graphene oxide for simultaneous hollowﬁber solid phase microextraction and electrochemical determination of anticancer drug imatinib in biological samples j', ' electroanal', 'chem', ' 801 2017 439e449', '128 z', ' moﬁdi p', ' norouzi b', ' larijani et al', ' simultaneous determination andextraction of ultratrace amounts of estradiol valerate from whole bloodusing fft square wave voltammetry and lowvoltage electrically enhancedmicroextraction techniques j', ' electroanal', ' chem', ' 813 2018 83e91', '129 z', ' tahmasebi s', 's', 'h', ' davarani a', 'a', ' asgharinezhad highly efﬁcient electrochemical determination of propylthiouracil in urine samples after selectiveelectromembrane extraction by copper nanoparticlesdecorated hollow ﬁbers biosens', ' bioelectron', ' 114 2018 66e71', '130 z', ' moﬁdi c', ' esmaeili p', ' norouzi et al', ' ultratrace determination of imipramine using a sr vo3 2 doped phytic acid carbon paste electrode afterpreconcentration by electromembrane extraction coupled with fft squarewave voltammetry j', ' electrochem', ' soc', ' 165 2018 h205eh212', '131 v', ' hrdlicka t', ' navratil j', ' barek application of hollow ﬁbre based microextraction for voltammetric determination of vanillylmandelic acid in human urine j', ' electroanal', ' chem', ' 835 2019 130e136', '132 a', ' oedit r', ' ramautar t', ' hankemeier et al', ' electroextraction and electromembrane extraction advances in hyphenation to analytical techniqueselectrophoresis 37 2016 1170e1186', '133 a', ' odobasic determination and speciation of trace heavy metals in naturalwater by dpasv isbn2012', '134 z', ' eshaghi a', ' nezhadali h', 'a', ' hosseini et al', ' preconcentration and determination of zinc in water samples by ligand assisted pseudo stirbar hollowﬁber solidliquid phase microextraction arab j chem 10 2017s3840es3847', 'njaimez m', ' joya j', ' barbaortega anodic stripping voltammetryeasv135 j', ' barofor determination of heavy metals j', ' phys', ' conf', ' ser', ' 2013 012023', ' ioppublishing', '', ''], 'Molecular Immune Pathogenesis And Diagnosis Of Covid 19': ['', 'coronavirus disease 2019 covid19 is a kind of viral pneumonia which is caused by severe acuterespiratory syndrome coronavirus 2 sarscov2', ' the emergence of sarscov2 has been marked asthe third introduction of a highly pathogenic coronavirus into the human population after the severeacute respiratory syndrome coronavirus sarscov and the middle east respiratory syndrome coronavirus merscov in the twentyﬁrst century', ' in this minireview we provide a brief introduction of thegeneral features of sarscov2 and discuss current knowledge of molecular immune pathogenesisdiagnosis and treatment of covid19 on the base of the present understanding of sarscov and merscov infections which may be helpful in offering novel insights and potential therapeutic targets forcombating the sarscov2 infection', '', 'coronavirussarscov2sarscovmerscovpathogenesis', 'novel coronavirusinduced pneumonia which was named ascoronavirus disease 2019 covid19 by the who on the february11 2020 has rapidly increased in epidemic scale 1', ' on the sameday the international virus classiﬁcation commission announcedthat the novel coronavirus was named as severe acute respiratorysyndrome coronavirus 2 sarscov2', ' covid19 is not the ﬁrstsevere respiratory disease outbreak caused by the coronavirus', ' justin the past two decades coronaviruses have caused three epidemicdiseases namely covid19 severe acute respiratory syndromesars and middle east respiratory syndrome mers 2', ' at present the cases of covid19 have been found in many countriesaround the world 3', ' according to the latest data up to the march1 2020 the number of conﬁrmed cases in china reached 79968 ofwhich 2873 were dead and 41681 were cured', ' in addition tochina the number of conﬁrmed cases in other countries alsoreached 7041 of which 105 were dead and 459 were cured', ' on the31st of january 2020 the world health organization who', 'announced that covid19 was listed as the public health emergency of international concern pheic meaning that it may poserisks to multiple countries and requires a coordinated internationalresponse', ' the review tries to explain the molecular immunepathogenesis and diagnosis of covid19 and provide a referencefor the prevention and drug development of sarscov2 infectionbased on the recent research progress of sarscov2 and theknowledge from researches on sarscov and merscov', '2', ' virology of sarscov2coronaviruses are enveloped viruses with a positive sensesinglestranded rna genome 26e32 kb 4', ' four coronavirusgenera a b g d have been identiﬁed so far with human coronaviruses hcovs detected in the a coronavirus hcov229e andnl63 and b coronavirus merscov sarscov hcovoc43 andhcovhku1 genera 5', ' in late december 2019 patients presenting with cough fever and dyspnea with acute respiratory distresssyndrome ards due to an unidentiﬁed microbial infection werereported in wuhan china', ' virus genome sequencing of ﬁve patients with pneumonia hospitalized from december 18 todecember 29 2019 revealed the presence of a previously unknownbcov strain in all of them 6', ' this isolated novel bcov shows 88identity to the sequence of two batderived severe acute respiratory syndromes sarslike coronaviruses batslcovzc45 andbatslcovzxc21 and about 50 identity to the sequence of mershttpsdoi', 'org10', '1016j', 'jpha', '2020', '03', '00120951779 2020 xian jiaotong university', ' production and hosting by elsevier b', 'v', ' this is an open access article under the cc byncnd license httpcreativecommons', 'orglicensesbyncnd4', '0', 'x', ' li et al', '  journal of pharmaceutical analysis 10 2020 102e108cov 6', ' the novel bcov was then named sarscov2 by theinternational virus classiﬁcation commission', ' the phylogenetictree of sarslike coronaviruses complete genome sequences is103clearly depicted in fig', ' 1a', 'the genome of sarscov2 is similar to that of typical covs andcontains at least ten open reading frames orfs', ' the ﬁrst orfsfig', ' 1', ' the phylogenetic tree of sarslike coronaviruses complete genome sequences and genome of sarscov merscov and sarscov 2', 'a this phylogeny shows evolution of sarslike bcoronaviruses including samples from human n ¼ 20 bat n ¼ 22 civet n ¼ 3 and pangolin n ¼ 6', ' the phylogenetic tree ofcomplete genome sequences of coronaviruses was obtained and analyzed with nextstrain httpsgithub', 'comblabsarslikecov', ' b coronaviruses form enveloped and sphericalparticles of 100e160 nm in diameter', ' they contain a positivesense single stranded rna ssrna genome of 26e32 kb in size', ' in sarscov merscov and sarscov2 the 50 terminal twothirds of the genome orf1ab encodes polyproteins which form the viral replicase transcriptase complex', ' the other orfs on the onethird of the genome encode fourmain structural proteins spike s envelope e nucleocapsid n and membrane m proteins as well as several accessory proteins', '104x', ' li et al', '  journal of pharmaceutical analysis 10 2020 102e108orf1ab about twothirds of viral rna are translated into twolarge polyproteins', ' in sarscov and merscov two polyproteinspp1a and pp1ab are processed into 16 nonstructural proteinsnsp1nsp16 which form the viral replicase transcriptase complex7', ' those nsps rearrange membranes originating from the roughendoplasmic reticulum rer into doublemembrane vesicleswhere viral replication and transcription occur 89', ' the otherorfs of sarscov2 on the onethird of the genome encode fourmain structural proteins spike s envelope e nucleocapsid nand membrane m proteins as well as several accessory proteinswith unknown functions which do not participate in viral replication fig', ' 1b', 'several groups of scientists in china have all discovered thatsarscov2 just like sarscov requires the angiotensinconverting enzyme 2 ace2 1 as a receptor to enter cells 10', 'the binding of the virus with host cell receptors is a signiﬁcantdeterminant for the pathogenesis of infection', ' sarscov mostlikely originated in bats 11and adapted to nonbat ace2 variantsas it crossed species to infect humans 12', ' dipeptidyl peptidase 4dpp4 also known as cd26 was identiﬁed as a functional receptorfor merscov because the receptorbinding s1 domain of themerscov spike protein was copuriﬁed with dpp4 speciﬁcally fromlysates of susceptible huh7 cells 13', ' merscov can bind dpp4from multiple species which promotes the transmission to humansand other species and infection of cells from a large number ofspecies 14', ' a better understanding of the relative effects of receptor binding and protease action will help predict whether speciﬁc zoonotic coronaviruses infect humans and the possibility ofadaptation', 'vesicles containing the virus particles then fuse with the plasmamembrane to release the virus 2', '3', '2', ' antigen presentation in coronavirus infectionwhile the virus enters the cells its antigen will be presented tothe antigen presentation cellsapc which is a central part of thebodys antiviral immunity', ' antigenic peptides are presented bymajor histocompatibility complex mhc or human leukocyte antigen hla in humans and then recognized by virusspeciﬁccytotoxic t lymphocytes ctls', ' hence the understanding of antigen presentation of sarscov2 will help our comprehension ofcovid19 pathogenesis', ' unfortunately there is still lack of anyreport about it and we can only get some information from previous researches on sarscov and merscov', ' the antigen presentation of sarscov mainly depends on mhc i molecules 24but mhc ii also contributes to its presentation', ' previous researchshows numerous hla polymorphisms correlate to the susceptibility of sarscov such as hlab4601 hlab0703 hladrb11202 25 and hlacw0801 26 whereas the hladr0301hlacw1502 and hlaa0201 alleles are related to the protection from sars infection 27', ' in merscov infection mhc iimolecules such as hladrb11101 and hladqb1020 areassociated with the susceptibility to merscov infection 28', ' besides gene polymorphisms of mbl mannosebinding lectinassociated with antigen presentation are related to the risk of sarscov infection 29', ' these researches will provide valuable clues forthe prevention treatment and mechanism of covid19', '3', '3', ' humoral and cellular immunity3', ' pathogenesis of covid19patients with covid19 show clinical manifestations includingfever nonproductive cough dyspnea myalgia fatigue normal ordecreased leukocyte counts and radiographic evidence of pneumonia 15 which are similar to the symptoms of sarscov andmerscov infections 16', ' hence although the pathogenesis ofcovid19 is poorly understood the similar mechanisms of sarscov and merscov still can give us a lot of information on thepathogenesis of sarscov2 infection to facilitate our recognitionof covid19', '3', '1', ' coronavirus entry and replicationcoronavirus s protein has been reported as a signiﬁcant determinant of virus entry into host cells 2', ' the envelope spikeglycoprotein binds to its cellular receptor ace2 for sarscov 10and sarscov2 17 cd209la ctype lectin also called lsignfor sarscov 18 dpp4 for merscov 13', ' the entry of sarscovinto cells was initially identiﬁed to be accomplished by directmembrane fusion between the virus and plasma membrane 19', 'belouzard et al', ' 20 found that a critical proteolytic cleavage eventoccurred at sarscov s protein at position s20  mediated themembrane fusion and viral infectivity', ' merscov also has evolvedan abnormal twostep furin activation for membrane fusion 21', 'besides membrane fusion the clathrindependent and independent endocytosis mediated sarscov entry too 2223', ' after thevirus enters the cells the viral rna genome is released into thecytoplasm and is translated into two polyproteins and structuralproteins after which the viral genome begins to replicate 5', ' thenewly formed envelope glycoproteins are inserted into the membrane of the endoplasmic reticulum or golgi and the nucleocapsidis formed by the combination of genomic rna and nucleocapsidprotein', ' then viral particles germinate into the endoplasmicreticulumgolgi intermediate compartment ergic', ' at last theantigen presentation subsequently stimulates the bodys humoral and cellular immunity which are mediated by virusspeciﬁcb and t cells', ' similar to common acute viral infections the antibodyproﬁle against sarscov virus has a typical pattern of igm and iggproduction', ' the sarsspeciﬁc igm antibodies disappear at the endof week 12 while the igg antibody can last for a long time whichindicates igg antibody may mainly play a protective role 30 andthe sarsspeciﬁc igg antibodies primarily are sspeciﬁc and nspeciﬁc antibodies 2', ' comparing to humoral responses there aremore researches on the cellular immunity of coronavirus', ' the latestreport shows the number of cd4þ and cd8þ t cells in the peripheral blood of sarscov2infected patients signiﬁcantly is reducedwhereas its status is excessive activation as evidenced by highproportions of hladr cd4 3', '47 and cd38 cd8 39', '4 doublepositive fractions 31', ' similarly the acute phase response in patients with sarscov is associated with severe decrease of cd4þ tand cd8þ t cells', ' even if there is no antigen cd4þ and cd8þmemory t cells can persist for four years in a part of sarscovrecovered individuals and can perform t cell proliferation dthresponse and production of ifng 32', ' six years after sarscovinfection speciﬁc tcell memory responses to the sarscov speptide library could still be identiﬁed in 14 of 23 recovered sarspatients 33', ' the speciﬁc cd8þ t cells also show a similar effect onmerscov clearance in mice 34', ' these ﬁndings may providevaluable information for the rational design of vaccines againstsarscov2', '3', '4', ' cytokine storm in covid19the report in lancet shows ards is the main death cause ofcovid19', ' of the 41 sarscov2infected patients admitted in theearly stages of the outbreak six died from ards 15', ' ards is thecommon immunopathological event for sarscov2 sarscovand merscov infections 31', ' one of the main mechanisms forx', ' li et al', '  journal of pharmaceutical analysis 10 2020 102e108ards is the cytokine storm the deadly uncontrolled systemic inﬂammatory response resulting from the release of large amounts ofproinﬂammatory cytokines ifna ifng il1b il6 il12 il18il33 tnfa tgfb etc', ' and chemokines ccl2 ccl3 ccl5cxcl8 cxcl9 cxcl10 etc', ' by immune effector cells in sarscovinfection 1535e37', ' similar to those with sarscov individualswith severe merscov infection show elevated levels of il6 ifnaand ccl5 cxcl8 cxcl10 in serum compared to those with themildmoderate disease 38', ' the cytokine storm will trigger a violent attack by the immune system to the body cause ards andmultiple organ failure and ﬁnally lead to death in severe cases ofsarscov2 infection just like what occurs in sarscov and merscov infection 31', '3', '5', ' coronavirus immune evasionto better survive in host cells sarscov and merscov usemultiple strategies to avoid immune responses', ' the evolutionarilyconserved microbial structures called pathogenassociated molecular patterns pamps can be recognized by pattern recognitionreceptors prrs', ' however sarscov and merscov can inducethe production of doublemembrane vesicles that lack prrs andthen replicate in these vesicles thereby avoiding the host detectionof their dsrna 39', ' ifniifna and ifnb has a protective effecton sarscov and merscov infection but the ifni pathway isinhibited in infected mice 4041', ' accessory protein 4a of merscov may block the induction of ifn at the level of mda5 activation through direct interaction with doublestranded rna 42', 'besides orf4a orf4b orf5 and membrane proteins of merscov inhibit nuclear transport of ifn regulatory factor 3 irf3 andactivation of ifn b promoter 43', ' the antigen presentation can alsobe affected by the coronavirus', ' for example gene expressionrelated to antigen presentation is downregulated after merscovinfection 44', ' therefore destroying the immune evasion of sarscov2 is imperative in its treatment and speciﬁc drug development', '4', ' diagnosis of covid19clinical diagnosis of covid19 is mainly based on epidemiological history clinical manifestations and some auxiliary examinations such as nucleic acid detection ct scan immuneidentiﬁcation technology pointofcare testing poct of igmiggenzymelinked immunosorbent assay elisa and blood culture', 'however the clinical symptoms and signs of patients infected withsarscov2 are highly atypical including respiratory symptomscough fever dyspnea and viral pneumonia', ' therefore auxiliaryexaminations are necessary for the diagnosis of covid19 just asthe epidemiological history', '4', '1', ' nucleic acid detection technologythe two commonly used nucleic acid detection technologies forsarscov2 are realtime quantitative polymerase chain reactionrtqpcr and highthroughput sequencing', ' the authoritativeidentiﬁcation method for sarscov2 is virus blood culture andhighthroughput sequencing of the whole genome 1', ' howeverthe application of highthroughput sequencing technology inclinical diagnosis is limited because of its equipment dependencyand high cost', ' so rtqpcr is the most common effective andstraightforward method for detecting pathogenic viruses in respiratory secretions and blood 45', 'after the outbreak of sarscov2 in china many companiessoon launched rtqpcr test kits for clinical diagnosis', ' the chinesecenter for disease control and prevention china cdc recommends the use of speciﬁc primers and probes in the orf1ab and n105gene regions for sarscov2 detection by rtqpcr', ' the patient isdeﬁned as having a laboratoryconﬁrmed infection when bothtargetsarepositivehttpivdc', 'chinacdc', 'cnkyjz202001t20200121211337', 'html', ' chu et al', ' 46 described two 1step rtqpcr assays taqmanbased ﬂuorescence signal to detect twodifferent regions orf1b and n of the viral genome separately', ' thenegative control samples were all conﬁrmed as negative oneswhile samples from two sarscov2 infected patients wereconﬁrmed as positive ones in respiratory specimens by thismethod', ' another study showed that the positive rate of sarscov2 was 91', '7 1112 in the patients selfcollected saliva by using rtqpcr nonprobes sybr based ﬂuorescence signal which suggeststhat saliva is a promising noninvasive specimen for the diagnosismonitoring and infection control of patients with sarscov2infection 47', ' rtqpcr detection also showed high sensitivityand speciﬁcity for sarscov and merscov infection 48', ' however ﬁve patients with negative results of rtqpcr for sarscov2may present with positive chest ct ﬁndings and repeated swabtests rtqpcr eventually conﬁrmed that all patients were infected by sarscov2 49', ' the detection of sarscov using rtqpcrcan only achieve a sensitivity of 50e79 depending on the protocol used the sample type and number of clinical specimenscollected 50', ' thus it is essential to improve the detection rate ofrtqpcr for sarscov2 infection', ' besides rtqpcr has someother shortcomings including certain biological safety hazardsbrought by the retention and operation of patient samplescumbersome nucleic acid detection operations and long waitingtime for results', '4', '2', ' ct scans and other diagnostic methodsfor the diagnosis of covid19 although rtqpcr is speciﬁc itsfalsenegative rate cannot be ignored because of the severe consequences of missed diagnosis', ' so many clinicians proposed ctscans should be one necessary auxiliary diagnostic method becauseit is more sensitive', ' for individuals with a high clinical suspicion ofsarscov2 infection with negative rtqpcr screening a combination of repeated rtqpcr tests and chest ct scan may be helpful', 'especially the highresolution ct hrct for the chest is essentialfor early diagnosis and evaluation of disease severity of patientswith sarscov2 51', ' several studies have analyzed chest ct images of patients infected with sarscov2 5253', ' the typical ctimages show bilateral pulmonary parenchymal groundglass andconsolidative pulmonary opacities sometimes with a roundedmorphology and a peripheral lung distribution', ' lung involvementwith a peripheral predominance was also seen in patients withsarscov and merscov infections and the chest ct showed thatdisease progressed with groundglass opacities and consolidationwhich is similar to that of sarscov2 infection 5455', ' accordingto those ﬁndings ct scans have a great clinical diagnostic value forcovid19 especially in the high prevalence area of sarscov2infection', ' however ct scans also have some shortcomings suchas indistinguishability from other viral pneumonia and the hysteresis of abnormal ct imaging', 'given the shortcomings of the currently used nucleic aciddetection and ct scans for the diagnosis of covid19 clinical laboratories should apply some immunological detection kits thattarget viral antigens or antibodies as soon as possible', ' currentlypoct of igmigg and elisa kits for sarscov2 have been developed and pretested by some companies and have shown higherdetection rates than nucleic acid detection but there is still noproduct or published article', ' the sensitivity of sarscov nbasedigg elisa 94', '7 is signiﬁcantly higher than that of sarscov sbased igg elisa 58', '9 48 but the sensitivity of sarscov2 iggigm remains to be studied', ' hence developing other sensitive and106x', ' li et al', '  journal of pharmaceutical analysis 10 2020 102e108speciﬁc auxiliary methods is necessary and urgent for the diagnosisof covid19', '5', ' current treatment strategies for covid19just like sarscov and merscov 256 there is currently noclinically proven speciﬁc antiviral agent available for sarscov2infection', ' the supportive treatment including oxygen therapyconservation ﬂuid management and the use of broadspectrumantibiotics to cover secondary bacterial infection remains to bethe most important management strategy 15', ' according to theresearch on molecular mechanisms of coronavirus infection 57and the genomic organization of sarscov2 6 there are severalpotential therapeutic targets to repurpose the existing antiviralagents or develop effective interventions against this novelcoronavirus', '5', '1', ' virally targeted inhibitorsremdesivir an adenosine analogue that can target the rnadependent rna polymerase and block viral rna synthesis hasbeen a promising antiviral drug against a wide array of rna virusesincluding sarsmerscov infections in cultured cells 58 mice59 and nonhuman primate models 6061', ' the washingtondepartment of health administrated remdesivir intravenously ﬁrstand found that remdesivir might have potential protection fromsarscov2 infection 62', ' then remdesivir and chloroquine havebeen demonstrated to inhibit sarscov2 effectively in vitro 63', 'hence other nucleoside analogues such as favipiravir ribavirin andgalidesivir 5664 may be potentially clinically applicable againstsarscov2', ' chymotrypsinlike 3clike protease 3clpro andpapainlike protease plp are nonstructural proteins which havean essential function for coronaviral replication and can inhibit thehost innate immune responses 65', ' so 3clpro inhibitors such ascinanserin 66 and ﬂavonoids 67 and plp inhibitors such asdiarylheptanoids 68 are other attractive choices to ﬁght againstsarscov2', ' ace2 mediates sarscov2 entry into the cell as afunctional receptor of coronaviruses', ' so blocking the binding of sprotein with ace2 is also a meaningful strategy against sarscov2infection 10', 'sarscov2', 'currently there may be many promising targets for sarscov2but more laboratory and clinical evidence still should be explored', 'the who is working with chinese scientists to launch more than80 clinical trials on potential treatments for sarscov2', ' traditional chinese medicine seems to have some effects in the supportive treatments', ' some new pharmaceutical drugs including hivdrugs and stem cells were testiﬁed in those clinical trials', '6', ' conclusionin conclusion the occurrence and development of sarscov2depend on the interaction between the virus and the individualsimmune system', ' viral factors include virus type mutation viralload viral titer and viability of the virus in vitro', ' the individualsimmune system factors include genetics such as hla genes agegender nutritional status neuroendocrineimmune regulation andphysical status', ' these factors all contribute to whether an individual is infected with the virus the duration and severity of thedisease and the reinfection', ' in the early stages of the epidemicaccurate diagnosis helps control the spread of the disease', ' it isimperative to develop new safe accurate fast and simple newtechnologies for detecting sarscov2', ' of course physicians willintentionally intervene in the two factors to make them developinto a direction beneﬁcial to human health which can help patientsrecover as soon as possible', ' however it must not be considered thatmedical intervention can achieve a 100 curative effect', 'conﬂicts of interestthe authors declare that there are no conﬂicts of interest', 'acknowledgmentsthis work was supported by the national natural sciencefoundation of china project no', '81970029 and fundamentalresearch funds for the central universities of china the emergency projects on covid19', ' project no', 'xzy032020042', ' wesincerely thank the individuals who contributed to this workincluding xudong yang wenhua zhu jing xu fumeng huangmuhammad saadiq khan jiajun ren and xipeng wang', '5', '2', ' antibody and plasma therapyappendix a', ' supplementary datait has also been reported that there are many convalescent patients donating plasma against sarscov2 just as sarscov 69and merscov 70 trials', ' it has preliminary acquired favorableresults in acute severe sarscov2 patients', ' moreover the generation of recombinant human monoclonal antibody mab is afairly straightforward path to neutralize sarscov', ' cr3022 a sarscoronavirusspeciﬁc human monoclonal antibody can bindpotently with the receptorbinding domainrbd of sarscov2and has the potential to be developed as candidate therapeuticsof sarscov2 infections 71', ' other monoclonal antibodiesneutralizing sarscov such as m396 cr3014 could be an alternative for the treatment of sarscov2 72', '5', '3', ' vaccineseffective sarscov2 vaccines are essential for reducing diseaseseverity viral shedding and transmission thus helping to controlthe coronavirus outbreaks', ' there are several vaccination strategiesagainst sarscov merscov tested in animals including a liveattenuated virus viral vectors inactivated virus subunit vaccinesrecombinant dna and proteins vaccines 73', ' these studies are inprogress but it requires months to years to develop the vaccines for', '', '', '1 p', ' zhou x', 'l', ' yang x', 'g', ' wang et al', ' a pneumonia outbreak associated with anew coronavirus of probable bat origin nature 2020 httpsdoi', 'org10', '1038s4158602020127', '2 e', ' de wit n', ' van doremalen d', ' falzarano et al', ' sars and mers recent insights into emerging coronaviruses nat', ' rev', ' microbiol', ' 14 2016 523e534httpsdoi', 'org10', '1038nrmicro', '2016', '81', '3 j', 't', ' wu k', ' leung g', 'm', ' leung nowcasting and forecasting the potential domestic and international spread of the 2019ncov outbreak originating inwuhan china a modelling study lancet 2020 httpsdoi', 'org10', '1016s0140673620302609', '4 s', ' su g', ' wong w', ' shi et al', ' epidemiology genetic recombination andpathogenesis of coronaviruses trends microbiol', ' 24 2016 490e502 httpsdoi', 'org10', '1016j', 'tim', '2016', '03', '003', '5 s', ' perlman j', ' netland coronaviruses postsars update on replication andpathogenesis nat', ' rev', ' microbiol', ' 7 2009 439e450 httpsdoi', 'org10', '1038nrmicro2147', '6 r', ' lu x', ' zhao j', ' li et al', ' genomic characterisation and epidemiology of 2019novel coronavirus implications for virus origins and receptor binding lancet2020 httpsdoi', 'org10', '1016s0140673620302518', '7 a', 'r', ' fehr s', ' perlman coronaviruses an overview of their replication andpathogenesis methods mol', ' biol', ' 1282 2015 1e23 httpsdoi', 'org10', '1007x', ' li et al', '  journal of pharmaceutical analysis 10 2020 102e10897814939243871', '8 p', 's', ' masters the molecular biology of coronaviruses adv', ' virus res', ' 66 2006193e292 httpsdoi', 'org10', '1016s0065352706660053', '9 k', ' knoops m', ' kikkert s', 'h', ' worm et al', ' sarscoronavirus replication issupported by a reticulovesicular network of modiﬁed endoplasmic reticulumplos biol', ' 6 2008 httpsdoi', 'org10', '1371journal', 'pbio', '0060226 e226', '10 w', ' li m', 'j', ' moore n', ' vasilieva et al', ' angiotensinconverting enzyme 2 is afunctional receptor for the sars coronavirus nature 426 2003 450e454httpsdoi', 'org10', '1038nature02145', '11 x', 'y', ' ge j', 'l', ' li x', 'l', ' yang et al', ' isolation and characterization of a bat sarslikecoronavirus that uses the ace2 receptor nature 503 2013 535e538 httpsdoi', 'org10', '1038nature12711', '12 chinese sars molecular epidemiology consortium chinese molecular evolution of the sars coronavirus during the course of the sars epidemic inchinascience30320041666e1669httpsdoi', 'org10', '1126science', '1092002', '13 v', 's', ' raj h', ' mou s', 'l', ' smits et al', ' dipeptidyl peptidase 4 is a functional receptor for the emerging human coronavirusemc nature 495 2013251e254 httpsdoi', 'org10', '1038nature12005', '14 a', ' barlan j', ' zhao m', 'k', ' sarkar et al', ' receptor variation and susceptibility tomiddle east respiratory syndrome coronavirus infection j', ' virol', ' 88 20144953e4961 httpsdoi', 'org10', '1128jvi', '0016114', '15 c', ' huang y', ' wang x', ' li et al', ' clinical features of patients infected with 2019novel coronavirus in wuhan china lancet 2020 httpsdoi', 'org10', '1016s0140673620301835', '16 j', 's', ' peiris y', ' guan k', 'y', ' yuen severe acute respiratory syndrome nat', ' med', ' 102004 s88es97 httpsdoi', 'org10', '1038nm1143', '17 f', ' wu s', ' zhao b', ' yu et al', ' a new coronavirus associated with human respiratory disease in china nature 2020 httpsdoi', 'org10', '1038s4158602020083', '18 s', 'a', ' jeffers s', 'm', ' tusell l', ' gillimross et al', ' cd209l lsign is a receptor forsevere acute respiratory syndrome coronavirus proc', ' natl', ' acad', ' sci', ' u', 's', 'a', '101 2004 15748e15753 httpsdoi', 'org10', '1073pnas', '0403812101', '19 g', ' simmons j', 'd', ' reeves a', 'j', ' rennekamp et al', ' characterization of severeacute respiratory syndromeassociated coronavirus sarscov spikeglycoproteinmediated viral entry proc', ' natl', ' acad', ' sci', ' u', 's', 'a', ' 101 20044240e4245 httpsdoi', 'org10', '1073pnas', '0306446101', '20 s', ' belouzard v', 'c', ' chu g', 'r', ' whittaker activation of the sars coronavirusspike protein via sequential proteolytic cleavage at two distinct sites proc', 'natl', ' acad', ' sci', ' u', 's', 'a', ' 106 2009 5871e5876 httpsdoi', 'org10', '1073pnas', '0809524106', '21 j', 'k', ' millet g', 'r', ' whittaker host cell entry of middle east respiratory syndromecoronavirus after twostep furinmediated activation of the spike proteinproc', ' natl', ' acad', ' sci', ' u', 's', 'a', ' 111 2014 15214e15219 httpsdoi', 'org10', '1073pnas', '1407087111', '22 h', ' wang p', ' yang k', ' liu et al', ' sars coronavirus entry into host cells througha novel clathrin and caveolaeindependent endocytic pathway cell res', ' 182008 290e301 httpsdoi', 'org10', '1038cr', '2008', '15', '23 k', ' kuba y', ' imai t', ' ohtonakanishi et al', ' trilogy of ace2 a peptidase in thereninangiotensin system a sars receptor and a partner for amino acidtransporters pharmacol', ' ther', ' 128 2010 119e128 httpsdoi', 'org10', '1016j', 'pharmthera', '2010', '06', '003', '24 j', ' liu p', ' wu f', ' gao et al', ' novel immunodominant peptide presentationstrategy a featured hlaa2402restricted cytotoxic tlymphocyte epitopestabilized by intrachain hydrogen bonds from severe acute respiratory syndrome coronavirus nucleocapsid protein j', ' virol', ' 84 2010 11849e11857httpsdoi', 'org10', '1128jvi', '0146410', '25 n', ' keicho s', ' itoyama k', ' kashiwase et al', ' association of human leukocyteantigen class ii alleles with severe acute respiratory syndrome in the vietnamese population hum', ' immunol', ' 70 2009 527e531 httpsdoi', 'org10', '1016j', 'humimm', '2009', '05', '006', '26 y', 'm', ' chen s', 'y', ' liang y', 'p', ' shih et al', ' epidemiological and genetic correlates ofsevere acute respiratory syndrome coronavirus infection in the hospital withthe highest nosocomial infection rate in taiwan in 2003 j', ' clin', ' microbiol', ' 442006 359e365 httpsdoi', 'org10', '1128jcm', '44', '2', '359365', '2006', '27 s', 'f', ' wang k', 'h', ' chen m', ' chen et al', ' humanleukocyte antigen class i cw1502 and class ii dr 0301 genotypes are associated with resistance to severeacute respiratory syndrome sars infection viral immunol', ' 24 2011421e426 httpsdoi', 'org10', '1089vim', '2011', '0024', '28 a', 'h', ' hajeer h', ' balkhy s', ' johani et al', ' association of human leukocyte antigenclass ii alleles with severe middle east respiratory syndromecoronavirusinfection ann', ' thorac', ' med', ' 11 2016 211e213 httpsdoi', 'org10', '410318171737', '185756', '29 x', ' tu w', 'p', ' chong y', ' zhai et al', ' functional polymorphisms of the ccl2 andmbl genes cumulatively increase susceptibility to severe acute respiratorysyndrome coronavirus infection j', ' infect', ' 71 2015 101e109 httpsdoi', 'org10', '1016j', 'jinf', '2015', '03', '006', '30 g', ' li x', ' chen a', ' xu proﬁle of speciﬁc antibodies to the sarsassociatedcoronavirus n', ' engl', ' j', ' med', ' 349 2003 508e509 httpsdoi', 'org10', '1056nejm200307313490520', '31 z', ' xu l', ' shi y', ' wang et al', ' pathological ﬁndings of covid19 associated withacute respiratory distress syndrome lancet resp', ' med', ' 2020 httpsdoi', 'org10', '1016s221326002030076x', '32 y', 'y', ' fan z', 't', ' huang l', ' li et al', ' characterization of sarscovspeciﬁc memoryt cells from recovered individuals 4 years after infection arch', ' virol', ' 1541072009 1093e1099 httpsdoi', 'org10', '1007s0070500904096', '33 f', ' tang y', ' quan z', 't', ' xin et al', ' lack of peripheral memory b cell responses inrecovered patients with severe acute respiratory syndrome a sixyear followup study j', ' immunol', ' 186 2011 7264e7268 httpsdoi', 'org10', '4049jimmunol', '0903490', '34 j', ' zhao k', ' li c', ' wohlfordlenane et al', ' rapid generation of a mouse modelfor middle east respiratory syndrome proc', ' natl', ' acad', ' sci', ' u', 's', 'a', ' 111 20144970e4975 httpsdoi', 'org10', '1073pnas', '1323279111', '35 a', 'e', ' williams r', 'c', ' chambers the mercurial nature of neutrophils still anenigma in ards am', ' j', ' physiol', ' lung cell mol', ' physiol', ' 306 2014l217el230 httpsdoi', 'org10', '1152ajplung', '00311', '2013', '36 r', ' channappanavar s', ' perlman pathogenic human coronavirus infectionscauses and consequences of cytokine storm and immunopathology semin', 'immunopathol', ' 39 2017 529e539 httpsdoi', 'org10', '1007s002810170629x', '37 m', 'j', ' cameron j', 'f', ' bermejomartin a', ' danesh et al', ' human immunopathogenesis of severe acute respiratory syndrome sars virus res', ' 133 200813e19 httpsdoi', 'org10', '1016j', 'virusres', '2007', '02', '014', '38 c', 'k', ' min s', ' cheon n', 'y', ' ha et al', ' comparative and kinetic analysis of viralshedding and immunological responses in mers patients representing abroad spectrum of disease severity sci', ' rep', ' 6 2016 25359 httpsdoi', 'org10', '1038srep25359', '39 e', 'j', ' snijder y', ' van der meer j', ' zevenhovendobbe et al', ' ultrastructure andorigin of membrane vesicles associated with the severe acute respiratorysyndrome coronavirus replication complex j', ' virol', ' 80 2006 5927e5940httpsdoi', 'org10', '1128jvi', '0250105', '40 r', ' channappanavar a', 'r', ' fehr r', ' vijay et al', ' dysregulated type i interferonand inﬂammatory monocytemacrophage responses cause lethal pneumoniain sarscovinfected mice cell host microbe 19 2016 181e193 httpsdoi', 'org10', '1016j', 'chom', '2016', '01', '007', '41 r', ' channappanavar a', 'r', ' fehr j', ' zheng et al', ' ifni response timing relative tovirus replication determines mers coronavirus infection outcomes j', ' clin', 'invest', ' 130 2019 3625e3639 httpsdoi', 'org10', '1172jci126363', '42 d', ' niemeyer t', ' zillinger d', ' muth et al', ' middle east respiratory syndromecoronavirus accessory protein 4a is a type i interferon antagonist j', ' virol', ' 872013 12489e12495 httpsdoi', 'org10', '1128jvi', '0184513', '43 y', ' yang l', ' zhang h', ' geng et al', ' the structural and accessory proteins m orf4a orf 4b and orf 5 of middle east respiratory syndrome coronavirusmerscov are potent interferon antagonists protein cell 4 2013 951e961httpsdoi', 'org10', '1007s1323801330968', '44 v', 'd', ' menachery a', ' schafer k', 'e', ' burnumjohnson et al', ' merscov and h5n1inﬂuenza virus antagonize antigen presentation by altering the epigeneticlandscape proc', ' natl', ' acad', ' sci', ' u', 's', 'a', ' 115 2018 e1012ee1021 httpsdoi', 'org10', '1073pnas', '1706928115', '45 v', 'm', ' corman o', ' landt m', ' kaiser et al', ' detection of 2019 novel coronavirus2019ncov by realtime rtpcr euro surveill', ' 25 2020 httpsdoi', 'org10', '280715607917', 'es', '2020', '25', '3', '2000045', '46 d', 'k', 'w', ' chu y', ' pan s', 'm', 's', ' cheng et al', ' molecular diagnosis of a novel coronavirus 2019ncov causing an outbreak of pneumonia clin', ' chem', ' 2020httpsdoi', 'org10', '1093clinchemhvaa029', '47 k', 'k', ' to o', 't', ' tsang c', ' chikyan yip et al', ' consistent detection of 2019 novelcoronavirus in saliva clin', ' infect', ' dis', ' 2020 httpsdoi', 'org10', '1093cidciaa149', '48 p', 'c', ' woo s', 'k', ' lau b', 'h', ' wong et al', ' differential sensitivities of severe acuterespiratory syndrome sars coronavirus spike polypeptide enzymelinkedimmunosorbent assay elisa and sars coronavirus nucleocapsid proteinelisa for serodiagnosis of sars coronavirus pneumonia j', ' clin', ' microbiol', ' 432005 3054e3058 httpsdoi', 'org10', '1128jcm', '43', '7', '30543058', '2005', '49 x', ' xie z', ' zhong w', ' zhao et al', ' chest ct for typical 2019ncov pneumoniarelationship to negative rtpcr testing radiology 2020 200343 httpsdoi', 'org10', '1148radiol', '2020200343', '50 w', 'c', ' yam k', 'h', ' chan l', 'l', ' poon et al', ' evaluation of reverse transcriptionpcrassays for rapid diagnosis of severe acute respiratory syndrome associatedwith a novel coronavirus j', ' clin', ' microbiol', ' 41 2003 4521e4524 httpsdoi', 'org10', '1128jcm', '41', '10', '45214524', '2003', '51 y', ' pan h', ' guan s', ' zhou et al', ' initial ct ﬁndings and temporal changes inpatients with the novel coronavirus pneumonia 2019ncov a study of 63patients in wuhan china eur', ' radiol', ' 2020 httpsdoi', 'org10', '1007s0033002006731x', '52 h', ' shi x', ' han c', ' zheng evolution of ct manifestations in a patient recoveredfrom 2019 novel coronavirus 2019ncov pneumonia in wuhan chinaradiology 2020 200269 httpsdoi', 'org10', '1148radiol', '2020200269', '53 m', ' chung a', ' bernheim x', ' mei et al', ' ct imaging features of 2019 novelcoronavirus 2019ncov radiology 2020 200230 httpsdoi', 'org10', '1148radiol', '2020200230', '54 g', 'c', ' ooi p', 'l', ' khong n', 'l', ' muller et al', ' severe acute respiratory syndrometemporal lung changes at thinsection ct in 30 patients radiology 230 2004836e844 httpsdoi', 'org10', '1148radiol', '2303030853', '55 a', 'm', ' ajlan r', 'a', ' ahyad l', 'g', ' jamjoom et al', ' middle east respiratory syndromecoronavirus merscov infection chest ct ﬁndings ajr am', ' j', ' roentgenol', '203 2014 782e787 httpsdoi', 'org10', '2214ajr', '14', '13021', '56 a', ' zumla j', 'f', ' chan e', 'i', ' azhar et al', ' coronaviruses  drug discovery andtherapeutic options nat', ' rev', ' drug discov', ' 15 2016 327e347 httpsdoi', 'org10', '1038nrd', '2015', '37', '57 d', 'a', ' groneberg r', ' hilgenfeld p', ' zabel molecular mechanisms of severe acutex', ' li et al', '  journal of pharmaceutical analysis 10 2020 102e108respiratory syndrome sars respir', ' res', ' 6 2005 8 httpsdoi', 'org10', '11861465992168', 'm', 'k', ' lo r', ' jordan a', ' arvey et al', ' gs5734 and its parent nucleoside analoginhibit filo pneumo and paramyxoviruses sci', ' rep', ' 7 2017 43395 httpsdoi', 'org10', '1038srep43395', 't', 'p', ' sheahan a', 'c', ' sims s', 'r', ' leist et al', ' comparative therapeutic efﬁcacy ofremdesivir and combination lopinavir ritonavir and interferon beta againstmerscov nat', ' commun', ' 11 2020 222 httpsdoi', 'org10', '1038s41467019139406', 'e', ' de wit f', ' feldmann j', ' cronin et al', ' prophylactic and therapeutic remdesivir gs5734 treatment in the rhesus macaque model of merscov infection proc', ' natl', ' acad', ' sci', ' u', 's', 'a', ' 2020 httpsdoi', 'org10', '1073pnas', '1922083117', 'm', 'k', ' lo f', ' feldmann j', 'm', ' gary et al', ' remdesivir gs5734 protects africangreen monkeys from nipah virus challenge sci', ' transl', ' med', ' 11 2019httpsdoi', 'org10', '1126scitranslmed', 'aau9242', 'm', 'l', ' holshue c', ' debolt s', ' lindquist et al', ' first case of 2019 novel coronavirusin the united states n', ' engl', ' j', ' med', ' 2020 httpsdoi', 'org10', '1056nejmoa2001191', 'm', ' wang r', ' cao l', ' zhang et al', ' remdesivir and chloroquine effectivelyinhibit the recently emerged novel coronavirus 2019ncov in vitro cell res', '2020 httpsdoi', 'org10', '1038s4142202002820', 'e', ' de clercq new nucleoside analogues for the treatment of hemorrhagicfever virus infections chem', ' asian j', ' 14 2019 3962e3968 httpsdoi', 'org10', '1002asia', '201900841', 'y', ' chen q', ' liu d', ' guo emerging coronaviruses genome structure replication and pathogenesis j', ' med', ' virol', ' 92 2020 418e423 httpsdoi', 'org10', '1002jmv', '25681', 'l', ' chen c', ' gui x', ' luo et al', ' cinanserin is an inhibitor of the 3clikeproteinase of severe acute respiratory syndrome coronavirus and stronglyreduces virus replication in vitro j', ' virol', ' 79 2005 7095e7103 httpsdoi', 'org10', '1128jvi', '79', '11', '70957103', '2005', 's', ' jo s', ' kim d', 'h', ' shin et al', ' inhibition of sarscov 3cl protease by ﬂavonoids j', ' enzym', ' inhib', ' med', ' chem', ' 35 2020 145e151 httpsdoi', 'org10', '108014756366', '2019', '1690480', 'j', 'y', ' park h', 'j', ' jeong j', 'h', ' kim et al', ' diarylheptanoids from alnus japonicainhibit papainlike protease of severe acute respiratory syndrome coronavirus biol', ' pharm', ' bull', ' 35 2012 2036e2042 httpsdoi', 'org10', '1248bpb', 'b1200623', 'j', ' mairjenkins m', ' saavedracampos j', 'k', ' baillie et al', ' the effectiveness ofconvalescent plasma and hyperimmune immunoglobulin for the treatment ofsevere acute respiratory infections of viral etiology a systematic review andexploratory metaanalysis j', ' infect', ' dis', ' 211 2015 80e90 httpsdoi', 'org10', '1093infdisjiu396', 'k', 'l', ' koenig identifyisolateinform a modiﬁed tool for initial detection andmanagement of middle east respiratory syndrome patients in the emergencydepartment west', ' j', ' emerg', ' med', ' 16 2015 619e624 httpsdoi', 'org10', '5811westjem', '2015', '7', '27915', 'x', ' tian c', ' li a', ' huang et al', ' potent binding of 2019 novel coronavirus spikeprotein by a sars coronavirusspeciﬁc human monoclonal antibody emerg', '2020382e385httpsdoi', 'org10', '108022221751', '2020', '1729069', 'l', ' zhang y', ' liu potential interventions for novel coronavirus in china asystematic review j', ' med', ' virol', ' 2020 httpsdoi', 'org10', '1002jmv', '25707', 'r', 'l', ' graham e', 'f', ' donaldson r', 's', ' baric a decade after sars strategies forcontrolling emerging coronaviruses nat', ' rev', ' microbiol', ' 11 2013 836e848httpsdoi', 'org10', '1038nrmicro3143', '', ''], 'Molecular Pharmaceuticals': ['', 'molecular pharmaceutics a vision for the futurethe biomedical and pharmaceutical community is buzzingwith excitement about the potential novel therapies resultingfrom the genomic revolution bioinformatics stem cellresearch cloning chemical biology molecular and cellbiology and the basic and clinical implications of pharmacogenomics and pharmacogenetics', ' if the promises andexpectations hold the researchers in the pharmaceutical fieldwill have in the foreseeable future more therapeutic targetsthan we could have possibly imagined just 10 years agoand have multiple redundant strategies for identifying anddeveloping drug candidates', ' the nature of therapeutic agentsand delivery strategies that will emerge from all theseenterprises will probably keep changing and is likely to bedifferent from what we have seen in the past', ' in many caseswe will undoubtedly have good ideas regarding their pharmacologic mechanisms upon inception as well as specificlocations of action and their therapeutic concentrations', ' thesechanges often viewed as revolutionary and labeled as suchcertainly give us high hopes for the future', ' would theyhowever necessarily translate into more and better drugproducts and therapeutic modalities there is one thing thatis clearly changing these developments pose a tremendouschallenge to pharmaceutics or drug delivery and at thesame time provide accompanying opportunities', 'a majority of researchers in modern biomedical researchand in cell and molecular biology in particular often focustheir thinking and efforts primarily on discoveries of socalledbasic mechanisms while their share of active contributionsto drug development beyond that point tends to abate', ' tomany when certain therapeutic molecules exhibit goodspecific activities at relatively low concentrations in a testtube or a cell culture system they magically become drugsthrough a long yet mysterious process until they materializein the clinical setting', ' it is not entirely clear where thisattitude originates but we still have the inclination especiallyin the academic and basic science community not to soilour pure scientific hands with applicationoriented pharmaceutical drug product development', ' this i tend to believeis primarily due to the misconception about the science ofpharmaceutics', ' perhaps the black box of the drug productdevelopment process which certainly includes pharmaceutics has been viewed until relatively recently as being toomuch like engineering in nature and requiring little mechanismbased science', 'with the first two issues of molecular pharmaceutics onecannot help but appreciate the salient pharmaceutics orpharmaceutical sciences the discipline that focuses ontransforming the drug to a clinically viable therapeuticdrug product is indeed multidisciplinary and will becomeincreasingly so', ' even after refinement by the addition of thedescriptive term molecular to the name the range of researcharticles already seen in this journal derive from a multitudeof scientific disciplines', ' with the molecular and mechanisticemphasis drug delivery and pharmaceutics have beenchanging conceptually from a rather descriptive science intoa logical and mechanismbased science that demands amolecular explanation of how the process works', ' thepressure is now on the pharmaceutical scientists during thecourse of this evolution and revolution to incorporate intopharmaceutical research the rapidly expanding body ofknowledge in the molecular and cellular fields rather thanto focus exclusively in the traditional sense on formulatinga delivery strategy for a given drug candidate even with thesacrifice of the molecular understanding of the design', ' thiswill undoubtedly force us into more intimate and successfulcollaboration with a wide range of scientific fields whichinevitably requires educating scientists from all relevantdisciplines about the everevolving needs and concepts ofmolecular pharmaceutics', ' like other fields in sciencepharmaceutical sciences is truly multidisciplinary and molecular pharmaceutics will be less apt to evolve and progresswithout collaborative efforts from a wide range of scientificdisciplines', 'the editorial office and board of molecular pharmaceuticsare pleased with the recognition of the enormous potentialof the role provided by this particular forum in meeting theneeds of the molecular revolution in pharmaceutics', ' it is safeto say that we can be excited and optimistic about the futureof molecular pharmaceutics', 'kyungdall lee', '', '', '', '', '', '', ''], 'Multi Dimensional Visualization For The Morphology': ['', 'article historythe shapes of particles and their distribution in tablets controlled by pretreatment andreceived 29 july 2018tableting process determine the pharmaceutical performance of excipient like lubricant', 'revised 18 november 2018this study aims to provide deeper insights to the relationship of the morphology and spaaccepted 10 january 2019tial distribution of stearic acid sa with the lubrication efficiency as well as the resultingavailable online 1 march 2019tablet property', ' unmodified sa particles as flat sheetlike particles were firstly reprocessedby emulsification in hot water to obtain the reprocessed sa particles with spherical mor', 'stearic acid morphology spatial distribution srμcted glipizide tablets', 'excipients play an important role in the properties and performance of the final formulation of solid dosage forms suchas texture stability release and bioavailability 13', ' amongall the excipients lubricant can significantly change the dynamics of blending compression and the mechanical properties of compacts', ' the physical properties of lubricant such asmagnesium stearate stearic acid sa and talc can affect theirperformance in tablet and capsule formulations 4', ' for pharmaceutical operations such as blending roller compactiontablet manufacturing and capsule filling lubricants improvethe flowability of blends facilitate unit operations and powder processing properties by reducing the interparticle friction 56', ' in terms of the effect of lubricant particle properties sa can improve density stickiness and flowability ofpowdered excipientdrug mixtures', ' sa with a large surfacearea and small particle size has the best lubrication efficiencysince the increase of surface area can provide more surfacecoverage 47', ' ingredient spatial distribution is closely relatedto the quality attribute of tablet 89', ' to study the influenceof sa on the physical properties of tablets it should be verified that lubricant particles are homogeneously mixed withthe rest constituents of the formulation 10', ' systematic studies of threedimensional 3d material distribution in soliddosage forms are restricted with limited techniques', ' most ofthe existing researches using nearinfrared chemical imaging raman imaging or terahertz timedomain reflection spectroscopy have been confined to research the material distribution on the surface of a sample or the crosssectional specimen 1112', ' recently innovative research of synchrotron radiation xray microcomputed tomography srμct in conjunction with liquid chromatography enables materials spatial distribution visualization in tablets 13', 'srμct is an advanced tomographic imaging technologywhich employs synchrotron radiation the most intense artificial source of xray as an illuminating source to obtainthe internal and microstructural details of a solid sample atmicrometer scale', ' methods combining the obtained xray tomography image processing and 3d reconstruction have beendevised and evaluated to study systematically the researchedobjects', ' as srμct can reveal the morphology and internal 3dstructure and give a better understanding of the properties ofdifferent materials it has been used to extensively study geological specimens 1415 biomaterials 16 tablets 1718 andgranules 19', ' in contrast to conventional techniques srμctprovides a noninvasive scan quantitative visualization andevaluation of the 3d structures with highspeed imaging intensive strength and high spatial resolution', ' within pharmaceutical material science and drug delivery system researchsrμct has been applied to analyze the complex structuralsystems of hpmcbased extended release tablets and gain improved mechanistic knowledge on drug release 20', ' for excipients in common use like microcrystalline cellulose the highspatial resolution of srμct makes it possible to evaluate individual structure of particles processing behavior and to classify microcrystalline celluloses of the same grade from different manufacturers 21', '', 'this study details multidimensional comparative research of sa particles in the reference listed drug rld of glipizide tablets glucotrol  5 mg glipizide tablets prepared using unmodified sa gut and reprocessed sa grt', ' considering the potential influence of morphology and size of sa particles on spatial distribution and tablet properties efforts havebeen made to reprocess the common sa as flat sheetlike particles into sa particles with regular spherical morphology', ' saparticles before and after being compressed into tablets havebeen visualized and quantified in multidimension to verifythe effect of sa morphology on tablet quality', 'glipizide tablet glucotrol  5 mg manufactured by pfizer u', 's', 'pharmaceuticals group new york usa was the referencelisted drug rld', ' stearic acid 99', '5 sa and silicon dioxide99', '0 were purchased from huzhou prospect pharmaceutical co', ' ltd', ' zhejiang china', ' lactose 99', '5 microcrystalline cellulose 99', '0 mcc and starch 99', '5 were produced by shanghai yunhong pharmaceutical excipients co', 'ltd', ' shanghai china', ' glipizide 99', '5 and sodium laurylsulfate 99', '0 sls were supplied by sinopharm chemicalreagent co', ' ltd shanghai china', '', ' pure water was producedby water purification system academic millipore usa', 'about 300 mg sls was weighed and dissolved under ultrasonic agitation for 10 min in 150 ml pure water to get a solution 0', '2 wv', ' then 15 g sa was added into the sls solution', 'the system was moved directly to a magnetic heated stirreretsd5 ika germany at a rotor speed of 1000 rpm and controlled at 80 c for half an hour the melting point of sa is68', '8 c', ' after that the obtained emulsion of liquid sa and water was transferred to a vertical overhead stirrer 10 mmd15ika germany to stir at 1000 rpm', ' at the same time pure water 600 ml at 0 c was rapidly poured into the system whichresulted in a sudden fall in temperature below the meltingpoint of sa', ' the stir was prolonged further for 40 min', ' thesolid particles were collected by filtration with 0', '45 μm millipore filter and washed with 50 ml pure water', ' the obtained saparticles were dried in a desiccator for 24 h and sieved through100 mesh size to obtain reprocessed sa particles', 'unmodified sa particles were firstly sieved through 100 meshsize and the obtained ones were used for the determinationof flowability and tableting', ' the angle of repose of unmodifiedsa particles and reprocessed sa particles were measured using a powder tester pts hosokawa micron co', ' ltd', ' shanghai china', ' for each kind of sa particles the measurement ofangle of repose was analyzed in triplicate', 'preparation of glipizide tablets and determination ofmass and breaking forcefrom the label of glucotrol tablet published on the food anddrug administration inert ingredients used were sa silicondioxide lactose mcc and starch', ' unmodified sa particles orreprocessed sa particles 1', '5 ww were well blended withglipizide and other excipients specified in the prescription by abenchtop mixer vh2 tianhe machinery co', ' ltd', ' shanghaichina', ' tablet compaction experiments were conducted on abenchscale rotary tablet presser zps8 tianjiu machinery factory shanghai china equipped with 8', '0 mm diameter andshallow concave punches using compression force as 5 kn', 'forcemeasuring equipment was connected to strain gaugesrfs150e huqin equipement shanghai china which allowedthe pressure forces on the upper and under punches to be followed', ' the turret speed was set as 8 rpm', ' the filling depth ofmaterial was 5', '60 mm', ' mixed blend was directly compressedinto 198 mg tablets with thickness of 3', '80  0', '18 mm and diameter of 7', '62 mm', ' gut and grt were produced at the sametime die wall force and ejecting force of each tablet were alsorecorded for further analysis', 'the determination of mass was performed by weighingeach kind of tablet with an analytical balance cpa225d sartorius germany', ' according to the hardness test approvedby usp 1217 the breaking force of rld gut and grt weremeasured with a hardness tester ypd200c hengqin instrument equipment co', ' ltd', ' shanghai china by compressingthe tablets between two slowly moving jaws until they werecrushed', ' the mass and breaking force of each kind of glizipidetablet were measured from 6tablet samples', '2', '5', 'isolation of sa particles in tabletssa specific gravity s', 'g', ' 0', '86 at 20 c is practically insolublein water and less dense than water', ' lactose and starch are water soluble and glipizide s', 'g', ' 1', '29 silicon dioxide s', 'g', ' 2', '20and mcc s', 'g', ' 1', '271', '60 used in tablet are denser than water all the data come from pubchem', ' hence according to thedifference of solubility and density sa particles can be separated from the tablet in water system keeping their morphology and particle size unchanged', 'sa particles in rld gut and grt were isolated from active pharmaceutical ingredient api and other excipients byphysical method without changing their morphology', ' for eachkind of glipizide tablet three tablets were dipped into 10 mlice cold water 0 c', ' the tablets swelled slowly and disintegrated in 10 min', ' meanwhile ingredients were found floatingup in clusters', ' the suspension was allowed to set for another10 min at low temperature 010 c so that sa particles couldfloat in water completely', ' the buoyant layer about onethirdof the suspension was collected into a beaker', ' then cold water 0 c was added to the beaker up to 20 ml', ' after setting for10 min some ingredients were found at the bottom and extremely fine particles of sa floated on the water surface', ' thebuoyant layer was collected again and the same procedureswere repeated three times to isolate pure sa particles', ' the finally collected buoyant layer was transferred to an evaporating dish and placed in a desiccator at 20 c till fully dried', '2', '6', 'conventional morphological characterizationmorphological characterization of sa particles was carried outby scanning electron microscopy sem s4800 hitachi', ' to obtain sem photographs specimens were evenly immobilizedon a metal stub with doublesided adhesive tape and coatedwith a thin layer of gold before being observed under magnification', '2', '7', 'tablet structure measurement by srμctsrμct tomographic images of three kinds of glipizide tabletswere acquired with the bl13w1 beam line at shanghai synchrotron radiation facility ssrf', ' glipizide tablets were fixedon the sample stage with a doublesided adhesive tape to prevent any unexpected movements during scans', ' axis adjustment of the sample stage was also taken to make sure thatthere was no deviation in the horizontal direction during sample rotation', ' rld gut and grt were measured in different srμct scans', ' according to the preliminary experiments and references the imaging parameters have been optimized 2223', 'the tablets were scanned with a photon energy of 18', '0 kev', ' after penetration through the sample the xrays were convertedinto visible light by a yag ce scintillator 200 μm thickness', 'projections were magnified by diffractionlimited microscopeoptics 1', '25  magnification and digitized in highresolutionwith an effective pixel size of 5', '2 μm orca flash 4', '0 scientific cmos hamamatsu k', 'k', ' shizuoka pref', ' japan physicalpixel size 6', '5 μm', ' the exposure time affects the xray photon number reaching the detector', ' when the exposure timeincreases the flux used to capture a projection will be raisedas well as the analyzing time', ' in our study the exposure timewas 1 s', ' the distance between sample to detector dsd is alsoa key factor inline phase contrast srμct and especially useful for the imaging of materials with lowz elements and lowdensity', ' in order to enhance the contrast to show a small difference in density the dsd was also adjusted appropriatelyand was set at 12 cm', ' for each acquisition 900 projection images were captured with an angular step size of 0', '2 for 180', 'flatfield images i', 'e', ' xray illumination on the beam pathwithout the sample and darkfield images i', 'e', ' xray illumination off were also collected during each acquisition procedure so as to correct the electronic noise and variations in thexray source brightness', ' imaging acquisition time for each ctscan was 30 min', '2', '8', '3d structure reconstructionin order to enhance the quality of reconstructed slicespropagationbased phasecontrast extraction was successfully conducted as described previously in our report 24', 'software pitre phasesensitive xray image processing andtomography reconstruction which extracts information ofdiffraction enhanced imaging and pitre bm pitre batchmanager which executes a series of tasks that created viapitre 25 were applied to allow parallelbeam tomographyreconstruction for conventional absorption ct information', 'depending on the magnitude of xray absorption for different materials of the glipizide tablet gray level images werefig', ' 1  sem micrographs of unmodified sa ac and reprocessed sa df under different magnifications reveal that themorphology and size of reprocessed sa are more regular than those of unmodified sa', ' sem images of sa particles isolatedfrom rld g gut h and grt i show that the morphologies of these three kinds of sa particles are similar', 'formed and the gray levels of various materials were determined such that the sa particles of interest could be extractedfrom the 3d models by segmentation in imaging processing', 'threshold was defined and certain gray value correspondingto the sa particles was determined fig', ' 3 so that sa particlescan be separated from the solid matrix', ' the 3d rendered datawere analyzed by using the commercially available softwareamira version 6', '01 fei usa and image pro analyzer 3d version 7', '0 media cybernetics inc', ' bethesda md usa to obtain structural and morphological information of sa particlesin tablets', ' in line with the differences of materials in densitiesand molecular properties table s1 the precise profile parameters were calculated', '3', 'results and discussion3', '1', 'two dimensional morphology analysis of sa particlesthe morphology and surface characteristics of unmodifiedsa particles and reprocessed sa particles analyzed by semare presented in fig', ' 1', ' notably unmodified sa particlesfig', ' 1ac with flat sheetlike morphology are conspicuouslyvaried in size while reprocessed sa particles fig', ' 1df aretopographically more spherical and relatively more uniformin size', ' at individual particle level some particles of unmodified sa are larger in size with a smooth surface while someof reprocessed sa particles possess obscure invagination', ' inshort the morphology and size of reprocessed sa particlesare more regular than those of unmodified sa particles', ' thecomparatively big differences existing in unmodified and reprocessed sa particles make them distinguishable from eachother', 'sem images of sa particles isolated from rld fig', ' 1g gutfig', ' 1h and grt fig', ' 1i display similar appearance', ' dramaticchanges can be seen in the morphology of unmodified sa ingut from an irregular flat shape to much rounder morphology while no evident morphology changes are observed fromreprocessed sa', ' due to the low melting point of sa 68', '8 cmorphological changes of sa particles could be due to the heatproduction process of material mixing or tableting', ' the moreuniform of the sa particles morphology the more uniformforce applied to sa and the smaller frictional force among materials', '64asian journal of pharmaceutical sciences 15 2020 6068fig', ' 2  reconstruction and phase contrast extraction process include shadow projection after flatfield and darkfieldcorrections a projection after phase retrieval b reconstructed slice c truncated slice d 3d image of a tablet e and saparticles in the tablet f', 'sa particles were isolated according to the density and water solubility of each substance that formed the tablet whichwere further confirmed by thermal platform microscope inour work and more relevant researches will be carried out inlater studies', '3', '2', 'glipizide tablets measured by srμctby srμct scan original data of hundreds of shadow projections were firstly gotten fig', ' 2a but revealed no useful information', ' phase retrieval was performed with projection images using the software pitre for propagationbased phasecontrast extraction fig', ' 2b', ' then reconstructed 2d slices ofthe specimen were obtained and the value of α was calibratedfrom 32 bit to 8 bit gray value 0255 fig', ' 2c and 2d', ' the ctimage values graylevels provide information on the materialxray attenuation coefficient at each point in the image', ' as thereconstructed 2d slice fig', ' 3a of the rld radial middle layershow the lighter areas of the slice have a relatively high grayvalue and the darker areas with a low gray value', ' sa particleshave the lowest density among all the ingredients in glipizidetablet which reflects weaker xray absorption and the lowestgray value', ' thus it is certained that the small dark spots in theslice are the sa particles', ' fig', ' 3b is the partial magnificationof the slice which shows how the threshold of sa particlesdefined', ' as shown in the line profile fig', ' 3c of the selectedsa particle the steepest part of the line was chosen and themiddle value of its vertical coordinate was determined as thethreshold', ' in order to obtain as exact gray value of sa particles as possible the dark spots in different slices of differentglipizide tablets were calculated', ' as the threshold was definedand certain gray value corresponds to the sa particles was determined sa particles can be separated from the solid matrixfig', ' 2f which realistically reconstructs the morphology andposition of sa particles in tablets', 'then all the 2d slices were processed by amira to get thefull reconstructed 3d images of tablets fig', ' 2e', ' the 3d morphological information of hundreds even thousands of sa particles can be obtained and 3d quantitative parameters are calculated', ' besides the uniformity of sa particles spatial distribution in tablets is monitored via highresolution imaging using srμct', 'the use of nondestructive xray microtomography allowsone to characterize the density distribution of an individualtablet and then further characterize the particles within thetablet', ' the optimized 3d models provide full details of surfacemorphology and distribution of sa particles in the tablet', ' 3dimages of sa particles existed in tablets are presented fromtwo different perspectives fig', ' 4a c and e', ' partial magnifications of sa particles are also displayed fig', ' 4b d and fand each particle is colored randomly by image pro analyzer3d', ' the mapping spatial distribution of sa particles from 3doverall view shows that sa particles in rld fig', ' 4a and band in grt fig', ' 4e and f are uniformly distributed', ' in someparts of gut fig', ' 4c and d there are sa clusters and somezones are without sa particles reflecting that spatial distribution of sa particles is relatively heterogeneous in gut', ' thisphenomenon suggests that the interparticle friction variedgreater among different parts in gut when compared withrld and grt', ' the size of sa particles in rld and grt is moreregular than in gut', ' moreover sa particles exhibit most standard morphology in grt followed by in rld and then in gut65asian journal of pharmaceutical sciences 15 2020 6068fig', ' 3  2d original slice of the radial middle layer of the glipizide tablet a partial magnification of the slice containing theselected sa particle b and the line profile of the selected sa particle c', 'which can be seen from partial magnifications fig', ' 4b 4d and4f', ' apparently the size of sa particles in gut are less regularand the difference of morphological characteristics betweendifferent particle size ranges is also large', ' bigger sa particlesmay also result from the agglomeration of the particles in gutwhich most likely due to the different sa particles used', ' withthe powerful srμct technology physical state of sa particleslocated in solid dosage form is visualized from multiple visionperspectives with a high spatial resolution', '3d morphological parameters like sphericity equivalentdiameter area of surface volume total area of surface of saparticles as well as number of sa particles in the three kindsof tablets were calculated and tabulated in table 1', ' the frequency distributing graphs of sphericity and surface area ofsa particles in each kind of tablet are also shown in fig', ' 5 tovisually compare the differences by mathematical statistics', 'sphericity is usually defined as a ratio of the surface area of asphere having the same volume with the particle to the actualsurface area of the particle 26', ' the sphericity of a sphere is1 and any particle which is not a sphere will have sphericity less than 1 27', ' average value of sphericity for sa particles in grt is similar to that in rld while it is smaller ingut', ' both the standard deviation of sphericity and the frequency distributing graph of the sphericity fig', ' 5a indicatethe sphericity fluctuation of sa particles in grt is the smallest', ' whats more the morphology of sa particles in gut isthe most nonuniform which is clearly presented in the frequency distributing graph of sphericity', ' as sphericity of particles is thought to be related to the flowability 4 sa particlesused in grt and rld have better lubrication efficiency thanthose in gut', ' in addition the improved sphericity of sa particles in grt is undoubtedly owing to the reprocessing', 'equivalent diameter here is the diameter of a sphere withthe same volume as the target object', ' the average value ofequivalent diameter for sa particles in grt is the smallestwhile the standard deviation of equivalent diameter for saparticles in gut is the biggest', ' meanwhile for average valueof surface area and volume sa particles in grt rld and gutarise by their turns', ' therefore it is easy to conclude thatsa particles in grt are relatively small', ' because the usageamount of sa in gut and grt is the same the smaller particlesize contributes to larger number of particles', ' and the number of sa particles in grt is the biggest then in rld and followed by sa particles in gut', ' since the standard deviations ofsize parameters especially those of sa particles in gut are sohigh considering the average value of size parameters aloneis not enough to get accurate information', ' as mentioned earlier larger surface area contributes to improved lubrication efficiency', ' the total surface area of sa particles in gut is thesmallest reflecting that sa particles with the biggest particlesize in gut have no better lubrication efficiency than thosein the other two kinds of tablets', ' the frequency profiles fig', '5b of surface area indicate that rather than in gut the frequency distribution tendency of sa particles in grt are moresimilar with in rld', ' in short from the 3d measurement using srμct technology uniformly spherical sa particles wita narrow size distribution can be observed in grt which iscloser to the results in rld', ' the elaborate quantitative resultsof sa particles in tablet which cannot be obtained without thepowerful 3d visualization tool clearly have a profound significance for pharmaceutical design', 'rather than the conventional microscopic evaluations onlyrevealing incomplete morphology the 3d structural and morphological elucidation technique of srμct can satisfy the research requirements with reliable and comprehensive information in drug delivery system', ' furthermore the degree ofasian journal of pharmaceutical sciences 15 2020 6068fluctuation shown in standard deviations of 3d parameters isa reflection of the regularity in morphology', ' it is found thatsa particles in grt feature the best regular morphology thatshow superior flowability', ' sa particles in gut have the highest fluctuation range in morphology', ' particularly for surfacearea and volume standard deviations of sa particles in gutare much higher than those in the other two kinds of tablets', 'the dramatic visualization of srμct images offered a reliablesemiquantitative overview of the sa particles distribution intablets', ' overall compared with sa particles in gut those ingrt are more consistent with those in rld', 'as demonstrated by the excipient example presented inthis report accurate quantitative characterizations of component in tablet are possible when appropriate techniques areused', ' for srμct high spatial resolution and contrast imaging form the basis of reliable quantitative analysis', ' the spatial resolution in our study is 5', '2 μm and sa particles below5', '23 μm3 cannot be determined', ' the accuracy of the quantified srμct experiments also depends on the stability of xraybeam physical dimensions and intensity profile the detectionresponse characteristics and count rate ranges', '3', '3', 'flowability compression property and breaking forceanalysisthe angles of repose for unmodified sa particles and reprocessed sa particles are 52', '61  0', '90 and 49', '08  1', '23 respectively', ' for optimized sa particles the average value of angleof repose is smaller reflecting its better flowability than unmodified sa particles', ' what is more the existence of the traceamount of sls brings no improvement in the flowability of saparticles data are not be provided', ' average values of die wallforce of gut and grt are 0', '41 kn and 0', '47 kn and ejectingforce are 0', '23 kn and 0', '17 kn respectively', ' the die wall forceindicates favorable compaction properties that prevent problems such as capping during mass manufacturing of tablets28 the higher die wall force for grt indicates that reprocessed sa particles are more suitable for tableting', ' for ejecting force contrasted to unmodified sa particles reprocessedsa particles make the tablet formulation possess lower adhesive force and frictional force during ejection of grt fromthe die cavity', ' tablet breaking force is a critical parameter inpharmaceutical process quality control and depends on factors such as compression force particle size and interparticleforce 29', ' in our research breaking force evolution for rld70', '59  6', '82 n gut 86', '58  7', '91 n and grt 68', '09  4', '24 nindicates that the effect of sa particles on the breaking force oftablet is obvious', ' the breaking force increased with the degreeof irregularity of sa particles and grt is much closer to rld', 'combined with the srμct analysis it seems that more regular morphology with higher sphericity of sa particles resultedin a less interparticle force and decreased breaking force', ' itshould be noted that the gap of morphological parameters likeparticle volume surface area and total surface area betweengrt and rld are large but the breaking force of rld and grtare overlapping', ' while more importantly the order of thesemorphological parameters of rld grt and gut has the sametrend as that of the breaking forces of the three kinds of tabletsconsidering the mean  sd values', ' some complicated mathe67matical or logical relationship may exist between these morphological parameters and breaking force', ' after all it has beenconfirmed that the breaking force of tablets is affected by multiple factors and the specific mathematical relationship hasnot been reported so far', ' it is thought that the usage of different kinds of sa particles chiefly contributed to the morphological differences among sa particles in rld gut and grtand resulted in difference in tablet breaking force whereasthe compaction conditions may also have impact on the results that cannot be underestimated', ' more detailed analysesof these impacts are beyond the scope of the present reportbut deserve further investigation', '4', '', 'in this study a powerful structural method has been established for the characterization of morphology and spatial distribution of sa particles in tablet prepared with different morphologies of sa as a new way to research the material insolid dosage forms', ' the improved structural consistency between reprocessed sa particles in grt and sa particles inrld ensures high quality of glipizide tablets', ' for excipientslike sa to function according to its particle structure and spatial distributions in tablets 3d reconstruction and quantitative structure analysis by srμct significantly deepen insightsof solid dosage form design and evaluation as well as rational optimization of production process', ' more specificallythe novel methodology of excipient structure consistency research opens a new way to secure high quality for both genericand brand products of drugs in solid dosage forms', 'conflicts of interestthe authors declare that there is no conflicts of interest', 'acknowledgmentsthe authors are grateful for the financial support fromthe national science and technology major project2017zx09101001006', ' thanks to the bl13w1 beamlineof the ssrf for the precious beam time and help from theteam', 'supplementary materialssupplementary material associated with this article can befound in the online version at doi10', '1016j', 'ajps', '2019', '01', '001', '', '', '2 shojaee s kaialy w cumming ki nokhodchi a', 'comparative evaluation of drug release from aged prolongedpolyethylene oxide tablet matrices effect of excipient anddrug type', ' pharm dev technol 201621218995', '3 villalobos jr villafuerte rl', ' effect of carrier excipient andprocessing on stability of indorenate hydrochlorideexcipientmixtures', ' pharm dev technol 20016455161', '4 li jj wu ym', ' lubricants in pharmaceutical solid dosageforms', ' lubricants 2014212143', '5 fridrun p mia y', ' the influence of particle size and shape onthe angle of internal friction and the flow factor ofunlubricated and lubricated powders', ' int j pharm1996144218794', '6 wang j wen h desai d', ' lubrication in tablet formulations', 'eur j pharm biopharm 2010751115', '7 barra j somma r', ' influence of the physicochemicalvariability of magnesium stearate on its lubricant propertiespossible solutions', ' drug dev ind pharm 19962211110520', '8 amigo jm ravn c', ' direct quantification and distributionassessment of major and minor components inpharmaceutical tablets by nirchemical imaging', ' eur jpharm sci 20093727682', '9 sando g dubois j', ' seeing the chemicals in pharmaceuticaltablets with nir chemical imaging', ' chim oggi2010281402', '10 perrault m bertrand f chaouki j', ' an experimentalinvestigation of the effect of the amount of lubricant ontablet properties', ' drug dev ind pharm 201137223442', '11 wu z tao o cheng w yu l shi x qiao y', ' visualizingexcipient composition and homogeneity of compoundliquorice tablets by nearinfrared chemical imaging', 'spectrochim acta a mol biomol spectrosc 201286866316', '12 takeuchi i shimakura k ohtake h takayanagi j tomoda knakajima t et al', ' nondestructive analysis of structure andcomponents of tablet coated with film by the usage ofterahertz timedomain reflection spectroscopy', ' j pharm sci2014103125661', '13 zhang l wu l wang cf zhang gq yu l li hyet al', ' synchrotron radiation microcomputedtomographyguided chromatographic analysis displays thematerial distribution in tablets', ' anal chem2018905323844', '14 altman sj uchida m tidwell vc boney cm chambers bp', 'use of xray absorption imaging to examine heterogeneousdiffusion in fractured crystalline rocks', ' j contam hydrol20046912126', '15 tomioka s kozaki t takamatsu h noda n nisiyama skozai n et al', ' analysis of microstructural images of dry andwatersaturated compacted bentonite samples observedwith xray micro ct', ' appl clay sci 20104716571', '16 zhang mq zhou l deng qf xie yy xiao tq cao yzet al', ' ultrahighresolution 3d digitalized imaging of thecerebral angioarchitecture in rats using synchrotronradiation', ' sci rep 2015514982', '17 laity pr cameron re', ' synchrotron xray microtomographicstudy of tablet swelling', ' eur j pharm biopharm201075226376', '18 li h yin x ji j sun l shao q york p et al', ' microstructuralinvestigation to the controlled release kinetics of monolithosmotic pump tablets via synchrotron radiation xraymicrotomography', ' int j pharm 201242722705', '19 crean b parker a le roux d perkins m luk sy banks sret al', ' elucidation of the internal physical and chemicalmicrostructure of pharmaceutical granules using xraymicrocomputed tomography raman microscopy andinfrared spectroscopy', ' eur j pharm biopharm2010763498506', '20 yin xz li hy guo z wu l chen fw shao qet al', ' quantification of swelling and erosion in the controlledrelease of a poorly watersoluble drug using synchrotronxray computed microtomography', ' aaps j2013154102534', '21 fang lw yin xz wu l he yp he yz qin wet al', ' classification of microcrystalline celluloses viastructures of individual particles measured by synchrotronradiation xraymicrocomputed tomography', ' int j pharm2017531265867', '22 ren yq chen c chen rc zhou gz wang yd xiao tq', 'optimization of image recording distances for quantitativexray inline phase contrast imaging', ' opt express2011195417081', '23 yang s yin xz wang cf li hy he y xiao tq et al', ' releasebehaviour of single pellets and internal fine 3d structuralfeatures codefine the in vitro drug release profile', ' aaps j201416486071', '24 guo z yin xz liu cb wu l zhu wf shao qet al', ' microstructural investigation using synchrotronradiation xray microtomography reveals tastemaskingmechanism of acetaminophen microspheres', ' int j pharm2015499124757', '25 chen rc dreossi d mancini l menk r rigon l xiao tq', 'pitre software for phasesensitive xray image processingand tomograph y reconstruction', ' j synchrotron radiat201219583645', '26 barksdale rd kemp ma sheffield wj hubbard jl', 'measurement of aggregate shape surface area androughness', ' transportation research record1301', ' washingtonnational research council 1991', ' p', ' 10716', '27 mora cf kwan kh', ' sphericity shape factor and convexitymeasurement of coarse aggregate for concrete using digitalimage processing', ' cem concr res 20003033518', '28 kasa p bajdik j zsignond z pintyehodi k', ' study of thecompaction behaviour and compressibility of binarymixtures of some pharmaceutical excipients during directcompression', ' chem eng process 200948485963', '29 javaheri h carter p elkordy aa', ' wet granulation toovercome liquisolid technique issues of poor flowability andcompactibility a study to enhance glibenclamidedissolution', ' j pharm drug dev 201423112', '', ''], 'Nanotechnology And Vaccine Development': ['asian journal of pharmaceutical sciences 92014227e235hosted byavailable online at www', 'sciencedirect', 'comsciencedirectjournal homepage httpees', 'elsevier', 'comajpsdefault', 'aspreviewnanotechnology and vaccine developmentmigyeong kim a joo yeon park a yuna shon a gunwoo kim bgayong shim a yukyoung oh aacollege of pharmacy and research institute of pharmaceutical sciences seoul national university seoul 151742republic of koreabdepartment of molecular medicine and biopharmaceutical sciences graduate school of convergence scienceseoul national university daehakdong gwanankgu seoul republic of koreaarticle info', 'article historydespite the progress of conventional vaccines improvements are clearly required due toreceived 28 march 2014concerns about the weak immunogenicity of these vaccines intrinsic instability in vivoreceived in revised formtoxicity and the need for multiple administrations', ' to overcome such problems nano7 june 2014technology platforms have recently been incorporated into vaccine development', 'accepted 9 june 2014nanocarrierbased delivery systems offer an opportunity to enhance the humoral andavailable online 18 june 2014cellular immune responses', ' this advantage is attributable to the nanoscale particle sizewhich facilitates uptake by phagocytic cells the gutassociated lymphoid tissue and thekeywordsmucosaassociated lymphoid tissue leading to efficient antigen recognition and presennanotechnologytation', ' modifying the surfaces of nanocarriers with a variety of targeting moieties permitsvaccine deliverythe delivery of antigens to specific cell surface receptors thereby stimulating specific andliposomesselective immune responses', ' in this review we introduce recent advances in nanocarrieremulsionsbased vaccine delivery systems with a focus on the types of carriers including liposomespolymeric nanocarriersemulsions polymerbased particles and carbonbased nanomaterials', ' we describe thecarbon nanomaterialsremaining challenges and possible breakthroughs including the development of needlefree nanotechnologies and a fundamental understanding of the in vivo behavior and stability of the nanocarriers in nanotechnologybased delivery systems', ' 2014 shenyang pharmaceutical university', ' production and hosting by elsevier b', 'v', ' this isan open access article under the cc byncnd license httpcreativecommons', 'orglicensesbyncnd3', '0', '1', '', '', 'the seasonal outbreaks of pantropic infection diseases haveelevated the development of effective vaccines to the status ofa global healthcare concern', ' vaccines have been developedusing killed organisms 1 live attenuated organisms 2 orinactivated toxins 3', ' recently subunit vaccines 4 and dnavaccines that encode antigenic pathogenic proteins 5 havebeen examined as new vaccine modalities', ' although subunitvaccines and dna vaccines have the advantages of a highsafety profile over traditional vaccine these vaccines sufferfrom a relatively lower immunogenicity', ' the immunogenicitymay potentially be improved by modulating the vaccineformulation using nanotechnology', ' corresponding authors', ' tel þ82 2 880 2493 fax þ82 2 882 2493', 'email addresses shimgsnu', 'ac', 'kr g', ' shim ohyksnu', 'ac', 'kr y', 'k', ' oh', 'peer review under responsibility of shenyang pharmaceutical university', 'httpdx', 'doi', 'org10', '1016j', 'ajps', '2014', '06', '00218180876 2014 shenyang pharmaceutical university', ' production and hosting by elsevier b', 'v', ' this is an open access article under thecc byncnd license httpcreativecommons', 'orglicensesbyncnd3', '0', '228the nanotechnologies developed for use in the field ofvaccines encompass nanocarriers having a variety of compositions sizes and surface properties 6', ' numerous vaccinenanocarriers have been designed and investigated for theirutility in the delivery of antigens and adjuvants to immunecells in an effort to promote a protective immune response', 'unfortunately although antigens may be taken up by theimmune cells insufficient adjuvant activity may result inlimited immunogenicity', ' in some approaches nanocarriershave been designed to codeliver both an antigen and anadjuvant 7', ' nanocarriers can facilitate the targeting andorsustained release of antigens or adjuvants to antigenpresenting cells 89', 'working mechanisms of nanotechnologybased vaccineformulations support the utility of nanocarriers in the vaccinefields', ' particles smaller than 10 mm are readily taken up byphagocytic cells such as macrophages and dendritic cellsdc', ' this property has been used to improve the cellularuptake of antigens thereby increasing the efficiency of antigen recognition and presentation 10', ' solid nanocarriers canprotect proteinbased antigen vaccines from degradation andfacilitate entry into the gutassociated lymphoid tissue andmucosaassociated lymphoid tissues rendering them appropriate for vaccine delivery via oral or mucosal routes 11', 'surfacemodified nanocarriers may assist the targeted delivery of antigens', ' immune cells express a variety of surfacereceptors including the mannose receptor scavenger receptor and tolllike receptors tlr 12', ' nanocarriers coated withimmune celltargeting molecules such as carbohydrates 13antibodies 14 and peptides 15 may target these overexpressed receptors to improve the efficiency of antigen andadjuvant delivery toward the promotion of specific and selective immune responses in prophylactic vaccines', 'this review provides an overview of recent advances innanocarrier vaccine systems including liposomes emulsionspolymerbased nanodelivery systems and carbonbasednanodelivery systems fig', ' 1', ' the current status of in vivoapplications of nanocarriers is summarized in table 1', '2', 'nanodelivery systems for vaccines2', '1', 'liposomessince the first report that liposomes can act as immunologicaladjuvants 16 liposome formulations fig', ' 1a have beenextensively studied for use in vaccine delivery systems', ' as ofthis publication at least 8 liposomal vaccines are in clinicaltrials or have been approved for human use 17', ' the physicochemical properties of liposomes including their size lipidcomposition and structure may be modulated according tothe properties of the vaccine antigen to maximize immunogenicity', ' liposomes are composed of biocompatible phospholipid bilayers and are capable of loading and delivering bothhydrophilic and hydrophobic molecules', ' these propertiesenable the codelivery of antigen and other molecules such asadjuvants', ' the surfaces of liposomes may be easily modifiedusing the appropriate functionally active lipid as a componentof the lipid bilayer', ' surfacemodified liposomes have beendesignedtotargetimmunecellscodeliverfig', ' 1 e structure of nanocarriers for vaccine antigendelivery', ' a liposomes b emulsions c polymericnanoparticles and d graphene oxide nanosheets', 'immunostimulatory agents and enhance both the humoraland cellmediated immune responses simultaneously toimprove the efficacy of liposomal vaccines', 'the physicochemical properties of liposomes such as theirsize and fluidity are important for the induction of an immune response', ' the vesicle sizes of liposomes composed ofcationic dimethyldioctadecylammonium dda can affect thecellmediated immune response but not the humoral immune response 18', ' liposomes larger than 2 mm in diameterwere found to effectively promote interleukin10 productionwhereas liposomes 500 nm in diameter promoted a higherlevel of interferong production in splenocytes', 'small unilamellar vesicles composed of cationic dda liposomes were found to produce higher cd8 t cell responsescompared to the larger multilamellar vesicles 19', ' a recentstudy reported that rigid dda lipidbased liposomes produceda th1directed immune response against antigens that was100 times greater than the response produced by fluidicdimethyldioleoylammonium dodabased liposomes 20', 'the liposomal delivery of protein antigens via surfaceadsorption methods may be optimized by tuning the surfaceantigen and lipid ratio', ' the protein surface antigentolipidratio can affect the aggregation behavior of liposomes andcan impact general vaccine stability during storage 21', ' surface modifications to antigencarrying liposomes gearingpolyethylene glycol peg groups can reduce liposome aggregation', ' however the retention of the liposomes at the injection sites was simultaneously reduced thereby altering theth1th2 immune response compared to the response produced by unmodified liposomes 22', 'the liposomal codelivery of antigens and an immunostimulatory molecule can enhance the generation of a protectiveimmune response', ' the entrapment of trehalose 66dibehenatetdb an immunostimulatory molecule within a liposome didnot affect the physicochemical properties of neutral distearoylsnglycero3phosphocholine dspc or cationic ddabased liposomes and significantly increased the production of ifngafter immunization 23', ' monophosphoryl lipid a mpl apoorly soluble tlr 4 agonist was added to the bilayers ofantigencationic liposomes composed of dda and tbd to increaseliposome membrane packing and reduce the surface charges', 'the mplddatdb liposomal formulation carried ovalbuminova as a model antigen', ' in mice the presence of mpl inliposomes did not affect the humoral immune response butsignificantly enhanced the antigenspecific cd8þ t cell immune response 24', ' some studies reported the use of an adjuvant formulation comprising liposomes containing animmunostimulatory molecule', ' the coadministration of atrivalent influenza vaccine and cationic liposomes containingtdb was found to augment both the humoral and the cellularimmune responses 25', 'interbilayercrosslinked multilamellar vesicles wererecently designed and tested as nanocarriers for protein antigens 26', ' the vesicles were formed by crosslinking the headgroups of lipid bilayers within anionic mutilamellar vesiclescomposed of 12dioleoylsnglycero3phosphocholine dopc12di9zoctadecenoylsnglycero3phospho1racglyceroldopg and maleimideheadgroup lipid 12dioleoylsnglycero3phosphoethanolaminen4pmaleimidophenyl butyramide mpb', ' interbilayer crosslinking via divalent magnesiumcationbased fusion permitted the stable entrapment ofprotein antigens within the core and lipophilic immunostimulatory molecules within the lipid membranes', ' ova was used asa model antigen to demonstrate that the interbilayercrosslinked vesicles provided the sustained release of antigensand enhanced the antigenspecific cd8þ t cell immuneresponse in comparison with the uncrosslinked liposomes', 'nickelchelating liposomes were examined for their potential use in histagmediated antigen vaccine loading 27', 'nickelchelating liposomes 100 nm in size were preparedusing egg phosphatidylcholine epc and a nickelchelatinglipid 12dioleoylsnglycero3n5amino1carboxypentyliminodiacetic acid succinyl nickel salt dogsntani in amolar ratio of 955', ' the histagged heat shock protein fromcandida albicans was loaded onto the surfaces of the nickelchelating liposomes via the formation of metallochelatingbonds by incubating the antigens with the liposomes', 'nickelchelating liposomes have also been prepared byincorporating nitrilotriacetic acid lipid derivatives into theliposomes to promote bonding to polyhistidinylated ovaantigens 28', ' the liposomes were composed of dogsntanidimyristoylphosphatidylcholinedmpcdimyristoylphosphatidylglycerol dmpg cholesterol and mplalthough these metallochelating liposomes offer meaningful progress toward recombinant protein antigen loadingwithout covalently modifying the antigens the toxicity ofthe nickelchelating lipids presents certain safety concernsfor clinical applications', 'liposomesinoil adjuvant formulations were found toprolong the immune response after vaccination 29', ' diphtheria toxoids were coencapsulated with poly ic in a liposome composed of lecithin and cholesterol 91 m ratio', ' thesubcutaneous injection of the liposomes suspended in oilmarcol 52montanide 888 91 generated a persistent immuneresponse by reducing antigen transport to the draining lymphnodes', 'cationic liposomes have been examined for their ability toenhance the adjuvanticity of nucleic acidbased tlr agonists', 'liposomes composed of the cationic lipid octadecenolyoxyethyl2heptadecenyl3 hydroxyethyl imidazolinium chloride and cholesterol were complexed to the tlr agonist cpgbased plasmid dna 30', ' the intramuscular administration ofthe combination of lipoplexes and fluzone an influenzavaccine was shown to provide an enhanced antibodyresponse and cell immunity in mice 30 and in elderly rhesusmacaques 31', '2', '2', 'emulsionsemulsions have been long studied as adjuvant formulationsand more recently studied as vaccine delivery systems', 'emulsions are dispersions of two or more immiscible liquidscomposed of oil emulsifiers and excipients fig', ' 1b', ' twobroad classes of emulsions may be formed waterinoilemulsions and oilinwater emulsions', ' the latter emulsiontype is typically used in adjuvant formulations', 'the most famous vaccine adjuvant emulsion is mf59', ' mf59consists of squalene oil span 85 and tween 80 in a citratebuffer', ' the mf59adjuvanted seasonal flu vaccine fluadwas approved in europe in 1997 32', ' mf59 can effectively increase the immune response in infants and young children33', ' a recent study investigated the role of each component ofmf59 toward the adjuvant properties 34', ' span 85 was foundto activate the muscle transcriptome', ' however span 85 alonedid not provide an efficient immune response comparable tothat of mf59', 'mf59 was studied for its ability to augment the induction ofantibodies against meningococcal protein antigens 35 andthe neisseria meningitidis b vaccine 36', ' the delivery of recombinant meningococcal b protein antigens in conjunctionwith the tlr4 agonist e6020 within mf59 was shown to causea strong antigenspecific cd4 tcell response after threestaged intramuscular injections into cd1 mice 35', 'af03 another squalenebased emulsion has been used as avaccine adjuvant', ' af03 which consists of squalene sorbitanoleate and cetheareth12 is present in the marketed influenzavaccine humenza', ' recently the physicochemical propertiesof af03 were characterized to evaluate the longterm stabilityof the formulation', ' the surfactants in af03 were analyzedusing mass spectroscopy and highperformance liquidchromatographymass spectroscopy as quality control tests inemulsion manufacturing processes 3738', 'in addition to the squalenebased mf59 and af03 emulsions adjuvant nanoemulsion formulations have beendeveloped without squalene', ' for example an aqueousdispersion of w805ec composed of cetyl pyridinium chloridetween 80 ethanol and soybean oil in phosphatebufferedsaline or 0', '9 nacl was found to promote an immuneresponse to the model antigen ova via intranasal administration 39', ' the nasal adjuvanticity of the w805ec nanoemulsion was attributed to dendritic cell engulfment ofantigenloaded epithelial cells 40', 'glucopyranosyl lipid a gla a tlr4 agonist has beentested for its adjuvanticity in the context of oilinwateremulsion vaccine antigen formulations', ' for example gmz2a fusion protein component in an antifalciparum vaccinewas combined with gla in an oilinwater emulsion vaccineformulation 41', ' the immunostimulatory properties of glawere then compared with the properties of several otherimmunostimulatory agents formulated with gmz2', ' gla wasfound to display the highest antigenspecific igg2a and totaligg titers', ' another study reported that the immunogenicity ofa recombinant plasmodium vivax protein vaccine could beenhanced by subcutaneously codelivering the vaccine withgla in an oilinwater emulsion formulation 42', ' the intradermal administration of gla within oilinwater emulsionsto human skin explants was found to enhance the capacity ofskin dcs to activate both cd4þ t cells and the emigration oflangerhans cells within skin tissues 43', ' oilinwater emulsions containing gla and recombinant hemagglutinin arecurrently in phase 2 clinical trials for the prevention of seasonal influenza 44', ' the adjuvanticity of the hemagglutininemulsion prepared with gla was found to increase the titersof hemagglutininspecific antibodies relative to the formulation prepared without gla following intramuscular administration to healthy adults', 'the successful commercialization of squalenebasedemulsions in marketed vaccines suggests that emulsion adjuvant approaches warrant further exploration', ' formulationstability during storage and the development of biocompatibleoil components may be crucial concerns for the development ofnew emulsion formulations for vaccine delivery', '2', '3', 'synthetic polymerbased nanodelivery systemspolymeric nanocarriers fig', ' 1c have been examined as vaccine delivery systems to take advantage of their ability to offerthe controlled release of antigens or adjuvants', ' polylacticcoglycolic acid plga is the most widely used biodegradablesynthetic polymer nanocarrier with a relatively long history ofbiomedical use', ' the plga particle size has been varied andsurface modifications have been introduced into vaccine formulations for use in oral mucosal and systemic delivery', 'the sizes surface modification and release profiles ofplga particles were shown to affect the immunogenicity ofentrapped antigens', ' the average size of an aerosolized plgaor polyllactic acidbased nanoparticle pulmonary hepatitisb virus vaccine formulation was suggested to influence theimmunogenicity of the antigen 45', ' nanoparticles larger than500 nm induced the generation of antigenspecific secretaryiga more effectively than smaller nanoparticles 500 nm inrats', 'a s i a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 9  2 0 1 4  2 2 7 e2 3 5the surfaces of the plga polymeric nanoparticles weremodified with lipids to enable the codelivery of antigens andadjuvants 46', ' in a recent study the ova antigen was covalently anchored to a pegylated phospholipid bilayer coatingformed on the plga nanoparticle surfaces and a lipid adjuvantsuch as mpl or agalactosylceramide was incorporated into thelipid bilayer', ' subcutaneous codelivery of ova with mpl in thesurface lipid coating of plga nanoparticles was shown toenhance the antigenspecific igg titer values more than 10folds', ' other groups have conjugated a candidate p', ' vivax malaria antigen vmp001 to the surfaces of lipidcoated plgaparticles and mpl has been incorporated into the lipid membranes 47', ' in the study plga particle surfaces were coatedwith lipids composed of dopc dopg and 12distearoylsnglycero3phosphoethanolaminenmaleimide', 'the prolonged release of antigens delivered by plgananoparticles was shown to enhance the immune response tothe model ova antigen 8', ' plga nanoparticles provided anova release profile that extended over 10 weeks and wasmuch slower than the release profile obtained from a liposomal formulation', ' in line with the sustained release profilean ovaeplga particulate vaccine formulation induced ahigher antibody titer compared to the liposome formulation 8weeks after subcutaneous administration in mice', 'the synthetic plga vaccine sel068 selecta bioscienceinc', ' usa is now in phase i clinical trials for the prevention ofnicotine addiction and relapse httpwww', 'selectabio', 'com', 'sel068 was designed to facilitate smoking cessation and isthe first nanovaccine to enter clinical trials', ' the sel068formulation incorporates a universal peptide antigen foreliciting t helper cell response and an immunostimulatingtlr agonist into the plga polymer matrix', ' nicotine a b cellantigen is covalently linked to the nanoparticle surfaces', ' nodoselimiting systemic toxicities were observed in a repeatdose glp safety and efficacy study in cynomolgus monkeys', 'other biodegradable polymers including poly εcaprolactone and polyanhydrides have been tested for their utilityin vaccine delivery applications', ' the h1n1 hemagglutininantigen was incorporated into chitosancoated polycaprolactone nanoparticles', ' intranasal delivery of the chitosanepolycaprolactonenanocarrierscontainingh1n1hemagglutinin was shown to produce serum igg levels andsecretory iga levels in nasal and lung lavage that were higherthan those produced following intranasal delivery of the soluble antigen to balbc mice 48', 'polyanhydride nanocarriers have been tested as vaccinedelivery systems to take advantage of their biodegradable andsafety profiles', ' polyanhydride nanoparticles containing yersinia pestis antigens were examined for intranasal vaccination49', ' the recombinant protein f1ev was coloaded with theadjuvant mpl to induce the generation of f1evspecific antibodies detected 23 weeks postvaccination', ' polyanhydridemicroparticles were shown to be taken up by dc cells and toinduce antigenspecific proliferation of both cd4þ and cd8þt cells 50', 'numerous polymeric nanoparticles have been designed tophysically entrap antigens within polymer matrices', ' electrostatic polyplexes have also been tested for their utility indelivering subunit antigens 51 or plasmid dna vaccines5253', ' hepatitis b surface antigen was loaded onto cationic l231poly lactic acid microspheres via the formation of electrostaticcomplexes 51', ' a single subcutaneous immunization withhbsag complexed onto the surfaces of cationic microsphereswas found to induce comparable levels of serum igg responses and higher cellular immune responses as comparedto two injections of hbsag with adjuvant alum in a mousemodel', 'cationic polymers have been used to form complexes withnegatively charged plasmid dna vaccines', ' deacylatedcationic polyethyleneimine was used to form complexes withthe human immunodeficiency virus hiv cn54gp140 antigen52', ' pulmonary administration of the polyplexes elicited animmune response and protected the immunized mice againstviral challenge', ' pegylated poly 2nndimethylaminoethylmethacrylate was used to deliver hiv gag dna vaccine 53', 'intranasal administration of the polyplexes was observed toenhance the gagspecific serum igg levels and ifng secretingsplenocytes in mice as compared to the naked dna vaccinetreated group', 'synthetic polymerbased vaccine delivery systems canprovide a sustained release profile for vaccine antigens overprolonged periods of time', ' the release profile may be tuned bycontrolling the molecular weights of the synthetic polymersand the encapsulation conditions', ' relatively few biodegradable and biocompatible synthetic polymeric delivery systemshave been tested to date and the safety profiles of the biodegradation products have not been extensively studied', ' progressin the field of biodegradable polymer development is anticipated to accelerate polymerbased vaccine delivery studies', '2', '4', 'natural biopolymerbased nanodelivery systemsnatural biopolymers including chitosan and pullulan havebeen studied as vaccine or adjuvant delivery systems', ' chitosan is biocompatible nontoxic biodegradable and provides acationic charge that may facilitate endocytosis', ' in the contextof vaccine delivery chitosan displays valuable propertiesincluding mucoadhesiveness and an adjuvanticity that acts bypromoting the maturation of dcs', 'the mucoadhesiveness of chitosan has been exploited inmucosal vaccine delivery formulations', ' a recent studyshowed that an ntrimethyl chitosan nanocarrier carrying amodel antigen ova provided prolonged residence in nasalmucosa compared to plga nanoparticles bearing the sameantigen 54', ' whereas intramuscularly administered ntrimethyl chitosanbased vaccine formulations provided immune responses that were comparable to those generated bythe plgabased vaccine intranasally administered ntrimethyl chitosanbased vaccine formulations induced higherantigenspecific secretory iga levels compared to plga carriers', ' these results suggest the importance of mucoadhesiveness in vaccine carriers for enhancing the induction ofmucosal immunity', 'chitosan nanoparticles were studied as mucosal vaccinedelivery systems 55', ' chitosan nanoparticles that encapsulated the hemagglutininsplit influenza virus were preparedby ionically crosslinking the chitosan polymers in the presence of sodium tripolyphosphate', ' two intranasal vaccinationdoses of the hemagglutininsplit influenza virus entrapped inchitosan nanoparticles induced higher systemic and mucosaantibody responses compared to the responses generated by avaccine prepared from the hemagglutininsplit influenzavirus alone in mice', 'the intracellular fate of the hbsag encapsulated in chitosan nanoparticles has been examined 56', ' the cellular fatesof the hbsag and chitosan nanoparticles were followed byfluorescently labeling the hbsag and chitosan with cy3 andcy5 respectively', ' the hbsagcontaining chitosan nanoparticles were found to be endocytosed by bone marrowderived dc and the hbsag was found to dissociate from thenanoparticles 6 h after cellular uptake', ' the dissociation ofhbsag from the chitosan nanoparticles was thought to resultfrom the chitosan matrix degradation in the lysosome', 'cholesterylconjugated pullulan polymerbased nanoscalehydrogels were studied as potential vaccine vehicles 57', ' anontoxic subunit fragment of the clostridium botulinum typea neurotoxin bohca was loaded into the nanogel andadministered intranasally', ' the viscosity of the nanogel promoted the retention of bohca in the nasal mucosal layer', 'after release from the nanogel bohca was taken up by themucosal dcs', ' the intranasal nanogel formulations providedhigh titers of the antigenneutralizing serum igg and antigenspecific siga in the absence of additional mucosal adjuvants', 'synthetic and natural polymer hybrid vaccine deliverysystems have been investigated', ' for example chitosancoated polycaprolactone nanoparticles were developed forthe intranasal delivery of the recombinant influenza a virusacalifornia072009 h1n1 hemagglutinin protein 48', ' about66', '5 of entrapped antigens were released from the nanoparticles over 63 days', ' a single intranasal immunization withthe antigenloaded chitosancoated polycaprolactone nanoparticles resulted in a total igg response that exceeded theresponse achieved after a booster intramuscular administration of the free subunit antigen solution in balbc mice', '2', '5', 'carbonbased nanodelivery systemscarbonbased nanomaterials and carbon nanotubes inparticular were recently investigated as antigen delivery systems 58', ' carbonbased nanodelivery systems are insolublenondegradable and mimic bacteria in size and shape', ' carbonnanotubes are not intrinsically immunogenic display a lowtoxicity are capable of carrying multiple antigens and aretaken up rapidly by antigenpresenting cells', ' such featuressupport the feasibility of using carbon nanotubes as antigencarriers', 'zeinali and colleagues examined the utility of singlewalled carbon nanotubes swcnts in vaccine delivery systems 59', ' a purified tuberculin protein derivative was loadedonto a carboxyl groupfunctionalized swcnt through covalent binding', ' following subcutaneous administration theantigeneswcnt conjugate was found to stimulate the production by th1 cells of cytokines such as ifng and il12 atlevels comparable to those generated through administrationof the conventional tuberculosis bcg vaccine', 'a recent study reported the importance of carbon nanotube type on the induction of immunogenicity 60', ' in thestudy a commercially available fungicide azoxystrobin wasloaded onto four types of carbon nanotube short and singlewalled short and multiwalled long and singlewalled andlong and multiwalled', ' the resulting immune responses werethen compared', ' the short and multiwalled carbon nanotubes0', '5 mm in length and 50 nm in diameter were found to providethe highest antiazoxystrobin igg antibody titers in rabbits', 'carbon magnetic nanoparticles were constructed to permitthe tracing of carbonbased vehicles 61', ' magnetic resonanceimaging data showed that magnetic nanoparticles 20e80 nmin diameter were rapidly distributed to the spleen followed bythe kidneys and the inguinal lymph nodes', ' the preferentialtargeting of carbon magnetic nanoparticles to dcs was used toenrich dcs ex vivo using an external magnet', ' the biotinylatedmodel antigen hen egg lysozyme protein and the biotinylatedtlr ligand cpg were attached to avidincoated carbon magnetic nanoparticles to improve the induction of t cell activation and antigenspecific ifng responses compared to thefree protein antigen', 'the nanostructures of carbonbased materials were reported to affect the antigen presentation process 62', ' graphene oxide nanosheets fig', ' 1d differed from c60 fullerenesin its ability to promote antigen presentation to the t cells', ' c60fullerenes stimulated mhc class i antigen presentation ofova whereas graphene oxide suppressed antigen presentation by dcs', ' moreover unlike the c60 fullerenes grapheneoxide reduced the immunoproteasomes in dcs', 'although most carbonbased vaccine delivery systemshave been tested through systemic administration a recentstudy examined the feasibility of using carbon nanoparticles for oral vaccine delivery 63', ' carbon nanoparticles470 nm in diameter bearing 40e60 nm pores were synthesized using silica as a template', ' instead of loading the antigens via surface adsorption the model antigen bovineserum albumin was encapsulated within the meso andmacropores of the nanoparticles', ' the rigid structure of thenanoparticles resisted destruction in the oral digestive tractand appeared to protect the antigens from the harsh environments of the alimentary canal after oral delivery', ' inthis study the igg and cytokine immune responses elicitedby the oral bovine serum albumin entrapped in the porousnanoparticles were comparable to those elicited by parenteral administration of bovine serum albumin with freundsadjuvant', 'carbonbased nanomaterial vaccine delivery systems arerelatively new and less well studied than other systems', 'several investigations have indicated the feasibility of carbonbased systems for systemic or oral antigen delivery', ' futuredevelopments should demonstrate whether the lack ofbiodegradability will promote or reduce the safety of a carbonbased nano delivery system', '3', 'current  future developmentsnanotechnologybased vaccine delivery systems have beendeveloped to enhance the immunogenicity of a vaccine antigen by modulating antigen delivery to the immune cells', 'nanocarrier formulations of vaccines offer the advantages ofcodelivery of antigen and immunomodulator 64', ' numerousstudies have reported enhanced immunogenicity ofnanocarrierbased vaccines upon codelivery with an immunomodulator', ' single immunization of ova and mpl coformulated with the plga nanocarrier induced much highersystemic and mucosal immune responses after oral deliverythan ova alone 65', ' micelle formulations that include a pegmodified cationic polypeptide can codeliver ova and tlr3agonists while increasing vaccineinduced antibody production by more than a factor of 70 66', ' the subcutaneousvaccination of phresponsive micelle nanoparticles containing amphiphilic diblock copolymers conjugated to ova andcpg oligonucleotides displayed remarkably higher cd8þ tcell responses compared with the free form or a physicalmixture 67', 'in addition to the codelivery of antigens and immunomodulators modifying the surfaces of nanocarriers cancontribute to the delivery of antigens specifically to relevantimmune cells', ' imiquimod tlr7 agonistentrapped plgananocarriers were coated with a chitosan derivative nnntrimethylated chitosan to improve the protective responsegenerated by mucosal immunization 68', ' another chitosanderivative glycol chitosan was decorated onto the surfaces ofplga nanoparticles for use in a nasal vaccination 69', ' glycolchitosancoated plga nanoparticles showed a lower clearance rate and a higher local uptake in the nasal cavitycompared with chitosancoated plga nanocarriers', 'multifunctional nanovaccines can significantly increasethe immune response generated by the targetspecific effective and stable delivery of an antigen', ' however the use ofmanycomponent nanovaccines with complex structures canincrease production costs and complicate the manufacturingprocess', ' many nanovaccines have been manufactured insmall batches for research use 70', ' batchtobatch variationswith respect to particle size shape and quality are criticalproblems in the area of nanoparticle synthesis and theseproblems must be addressed during scaleup for clinical trialtesting 7172', ' surfacemodified nanoparticulate vaccinesrequire complicated synthesis procedures that can requirecomplex purification processes and high expenses', ' scaleupprocesses tend to be timeconsuming for pharmaceutical applications', ' selfassembled nanovaccine technologies wouldbe beneficial for reducing obstacles to the development ofindustrialscale manufacturing protocols', '4', 'conclusionsnanotechnology platforms present promising strategies forimproving the immunogenicity of a vaccine antigen', ' nanocarriers that are useful for the formulation and delivery ofantigens and adjuvants offer many advantages over alternative adjuvant approaches including improved stability sustained release kinetics lower immunotoxicity and targetingto specific and selective immune cells', ' in addition nanoparticles efficiently deliver antigens due to their nanoscalesize solid form ease of surface modification and ability tocodeliver antigens along with adjuvants', ' although the applications of nanotechnologies for nanocarrierbased vaccinedelivery are currently in a nascent investigational stage andonly a few products are being tested in clinical trials thesevaccine delivery systems may potentially be used morebroadly for the prevention and treatment of infectiousdisease', '233acknowledgmentthis work was supported by grants from the korean healthtechnology rd project ministry of health and welfaregrant no', ' a092010 and from ministry of science ict andfuture planning no', ' 2014023227 and from business forcooperative rd between industry academy and researchinstitute funded korea small and medium business administration no', ' c0010962', '', '', '', '', '1 naiman bm alt d bolin ca et al', ' protective killed leptospiraborgpetersenii vaccine induces potent th1 immunitycomprising responses by cd4 and gd t lymphocytes', ' infectimmun 2001697550e7558', '2 epstein je tewari k lyke ke et al', ' live attenuated malariavaccine designed to protect through hepatic cd8þ t cellimmunity', ' science 2011334475e480', '3 saha a chowdhury mi nazim m et al', ' vaccine specificimmune response to an inactivated oral cholera vaccine andepi vaccines in a high and low arsenic area in bangladeshichildren', ' vaccine 201331647e652', '4 norton eb lawson lb mahdi z et al', ' the a subunit ofescherichia coli heatlabile enterotoxin functions as amucosal adjuvant and promotes igg2a iga and th17responses to vaccine antigens', ' infect immun2012802426e2435', ' derholm j et al', ' coexpressed rigi5 luke jm simon gg soagonist enhances humoral immune response to influenzavirus dna vaccine', ' j virol 2011851370e1383', '6 peek lj middaugh cr berkland c', ' nanotechnology invaccine delivery', ' adv drug deliv rev 200860915e928', '7 dunkle a blanchette c boone t et al', ' codelivery ofadjuvant and subunit antigens via a nanoparticle platforminduces tissueassociated and systemic adaptive immuneresponses p4409', ' j immunol 2013190205e214', '8 demento sl cui w criscione jm et al', ' role of sustainedantigen release from nanoparticle vaccines in shaping the tcell memory phenotype', ' biomaterials 2012334957e4964', '9 gregory ae titball r williamson d', ' vaccine delivery usingnanoparticles', ' front cell infect microbiol 201331e13', '10 oyewumi mo kumar a cui z', ' nanomicroparticles asimmune adjuvants correlating particle sizes and theresultant immune responses', ' expert rev vaccines201091095e1107', '11 borges o borchard g verhoef jc et al', ' preparation of coatednanoparticles for a new mucosal vaccine delivery system', ' intj pharm 2005299155e166', '12 apostolopoulos v thalhammer t tzakos ag et al', 'targeting antigens to dendritic cell receptors for vaccinedevelopment', ' j drug deliv 2013', ' epub', '13 lepenies b lee j sonkaria s', ' targeting ctype lectinreceptors with multivalent carbohydrate ligands', ' adv drugdeliv rev 2013651271e1281', '14 raghuwanshi d mishra v suresh mr et al', ' a simpleapproach for enhanced immune response using engineereddendritic cell targeted nanoparticles', ' vaccine2012307292e7299', '15 misumi s masuyama m takamune n et al', ' targeteddelivery of immunogen to primate m cells with tetragalloyllysine dendrimer', ' j immunol 20091826061e6070', '16 allison ag gregoriadis g', ' liposomes as immunologicaladjuvants', ' nature 1974252252', '17 watson ds endsley an huang l', ' design considerations forliposomal vaccines influence of formulation parameters onantibody and cellmediated immune responses to liposomeassociated antigens', ' vaccine 2012302256e2272', '18 henriksenlacey m devitt a perrie y', ' the vesicle size ofdda tdb liposomal adjuvants plays a role in thecellmediated immune response but has no significanteffect on antibody production', ' j control release2011154131e137', '19 milicic a kaur r reyessandoval a et al', ' small cationicdda tdb liposomes as protein vaccine adjuvants obviatethe need for tlr agonists in inducing cellular and humoralresponses', ' plos one 20127e34255', '20 christensen d henriksenlacey m kamath at et al', ' acationic vaccine adjuvant based on a saturated quaternaryammonium lipid have different in vivo distribution kineticsand display a distinct cd4 t cellinducing capacity comparedto its unsaturated analog', ' j control release 2012160468e476', '21 hamborg m jorgensen l bojsen ar et al', ' protein antigenadsorption to the ddatdb liposomal adjuvant effect onprotein structure stability and liposome physicochemicalcharacteristics', ' pharm res 201330140e155', '22 kaur r bramwell vw kirby dj et al', ' pegylation of dda tdbliposomal adjuvants reduces the vaccine depot effect andalters the th1th2 immune responses', ' j control release201215872e77', '23 mcneil se rosenkrands i agger em et al', ' subunit vaccinesdistearoylphosphatidylcholinebased liposomes entrappingantigen offer a neutral alternative todimethyldioctadecylammoniumbased cationic liposomesas an adjuvant delivery system', ' j pharm sci20111001856e1865', '24 nordly p agger em andersen p et al', ' incorporation of thetlr4 agonist monophosphoryl lipid a into the bilayer ofddatdb liposomes physicochemical characterization andinduction of cd8þ tcell responses in vivo', ' pharm res201128553e562', '25 rosenkrands i vingsbolundberg c bundgaard tj et al', 'enhanced humoral and cellmediated immune responsesafter immunization with trivalent influenza vaccineadjuvanted with cationic liposomes', ' vaccine2011296283e6291', '26 moon jj suh h bershteyn a et al', ' interbilayercrosslinkedmultilamellar vesicles as synthetic vaccines for potenthumoral and cellular immune responses', ' nat mater201110243e251', '27 masek j bartheldyova e turanekknotigova p et al', 'metallochelating liposomes with associated lipophilisednorabumdp as biocompatible platform for construction ofvaccines with recombinant histagged antigens preparationstructural study and immune response towards rhsp90', 'j control release 2011151193e201', '28 watson ds platt vm cao l et al', ' antibody response topolyhistidinetagged peptide and protein antigens attachedto liposomes via lipidlinked nitrilotriacetic acid in mice', ' clinvaccine immunol 201118289e297', '29 de veer m neeland m burke m et al', ' cell recruitment andantigen trafficking in afferent lymph after injection ofantigen and polyi c containing liposomes in aqueous oroilbased formulations', ' vaccine 2013311012e1018', '30 lay m callejo b chang s et al', ' cationic lipiddna complexesjvrs100 combined with influenza vaccine fluzoneincreases antibody response cellular immunity andantigenically drifted protection', ' vaccine 2009273811e3820', '31 carroll td matzinger sr barry pa et al', ' efficacy of influenzavaccination of elderly rhesus macaques is dramaticallyimproved by addition of a cationic lipiddna adjuvant', 'j infect dis 201420924e33', '32 ohagan dt', ' mf59 is a safe and potent vaccine adjuvant thatenhances protection against influenza virus infection', ' expertrev vaccines 20076699e710', '33 vesikari t knuf m wutzler p et al', ' oilinwater emulsionadjuvant with influenza vaccine in young children', ' n engl jmed 20113651406e1416', '34 calabro s tritto e pezzotti a et al', ' the adjuvant effect ofmf59 is due to the oilinwater emulsion formulation noneof the individual components induce a comparable adjuvanteffect', ' vaccine 2013313363e3369', '35 singh m kazzaz j ugozzoli m et al', ' mf59 oilinwateremulsion in combination with a synthetic tlr4 agoniste6020 is a potent adjuvant for a combinationmeningococcus vaccine', ' hum vaccin immunother20128486e490', '36 brito la chan m baudner b et al', ' an alternative renewablesource of squalene for use in emulsion adjuvants', ' vaccine2011296262e6268', '37 klucker mf dalencon f probeck p et al', ' af03 an alternativesqualene emulsionbased vaccine adjuvant prepared by aphase inversion temperature method', ' j pharm sci20121014490e4500', '38 cotte jf sonnery s martial f et al', ' characterization ofsurfactants in an oilinwater emulsionbased vaccineadjuvant using ms and hplcms structural analysis andquantification', ' int j pharm 2012436233e239', '39 makidon pe nigavekar ss bielinska au et al', 'characterization of stability and nasal delivery systems forimmunization with nanoemulsionbased vaccines', ' j aerosolmed pulm drug deliv 20102377e89', '40 myc a kukowskalatallo jf smith dm et al', 'nanoemulsion nasal adjuvant w805ec induces dendriticcell engulfment of antigenprimed epithelial cells', ' vaccine2013311072e1079', '41 lousadadietrich s jogdand ps jepsen s et al', ' a synthetictlr4 agonist formulated in an emulsion enhances humoraland type 1 cellular immune responses against gmz2aglurpmsp3 fusion protein malaria vaccine candidate', 'vaccine 2011293284e3292', '42 lumsden jm nurmukhambetova s klein jh et al', ' evaluationof immune responses to a plasmodium vivax cspbasedrecombinant protein vaccine candidate in combination withsecondgeneration adjuvants in mice', ' vaccine2012303311e3319', '43 schneider lp schoonderwoerd aj moutaftsi m et al', 'intradermally administered tlr4 agonist glase enhancesthe capacity of human skin dcs to activate t cells andpromotes emigration of langerhans cells', ' vaccine2012304216e4224', '44 treanor jj essink b hull s et al', ' evaluation of safety andimmunogenicity of recombinant influenza hemagglutininh5indonesia052005 formulated with and without a stableoilinwater emulsion containing glucopyranosyllipid aseþgla adjuvant', ' vaccine 2013315760e5765', '45 thomas c rawat a hopeweeks l et al', ' aerosolized pla andplga nanoparticles enhance humoral mucosal and cytokineresponses to hepatitis b vaccine', ' mol pharm 20118405e415', '46 bershteyn a hanson mc crespo mp et al', ' robust iggresponses to nanograms of antigen using a biomimetic lipidcoated particle vaccine', ' j control release 2012157354e365', '47 moon jj suh h polhemus me et al', ' antigendisplaying lipidenveloped plga nanoparticles as delivery agents for aplasmodium vivax malaria vaccine', ' plos one 20127e31472', '48 gupta pn vyas sp', ' investigation of lectinized liposomes asmcell targeted carrieradjuvant for mucosal immunization', 'colloids surf b biointerfaces 201182118e125', '49 ulery bd kumar d ramertait ae et al', ' design of aprotective singledose intranasal nanoparticlebased vaccineplatform for respiratory infectious diseases', ' plos one20116e17642', 'torres mp wilsonwelder jh lopac sk et al', ' polyanhydridemicroparticles enhance dendritic cell antigen presentationand activation', ' acta biomater 201172857e2864', 'saini v jain v sudheesh ms et al', ' humoral and cellmediated immuneresponses after administration of asingleshot recombinant hepatitis b surface antigen vaccineformulated with cationic polyllactide microspheres', ' j drugtarget 201018212e222', 'jf1 mann mckay pf arokiasamy s et al', ' pulmonary deliveryof dna vaccine constructs using deacylated pei elicitsimmune responses and protects against viral challengeinfection', ' j control release 2013170452e459', 'y1 qiao huang y qiu c et al', ' the use of pegylated poly2nndimethylamino ethyl methacrylate as a mucosaldna delivery vector and the activation of innate immunityand improvement of hiv1specific immune responses', 'biomaterials 201031115e123', 'slutter b bal s keijzer c et al', ' nasal vaccination withntrimethyl chitosan and plga based nanoparticlesnanoparticle characteristics determine quality and strengthof the antibody response in mice against the encapsulatedantigen', ' vaccine 2010286282e6291', 'sawaengsak c mori y yamanishi k et al', ' chitosannanoparticle encapsulated hemagglutininsplit influenzavirus mucosal vaccine', ' aaps pharmscitech201415317e325', 'lugade aa bharali dj pradhan v et al', ' single lowdoseunadjuvanted hbsag nanoparticle vaccine elicits robustdurable immunity', ' nanomedicine 20139923e934', 'nochi t yuki y takahashi h et al', ' nanogel antigenicproteindelivery system for adjuvantfree intranasalvaccines', ' nat mater 20109572e578', 'scheinberg da mcdevitt mr dao t et al', ' carbon nanotubesas vaccine scaffolds', ' adv drug deliv rev 2013652016e2022', 'zeinali m jammalan m ardestani sk et al', ' immunologicaland cytotoxicological characterization of tuberculin purifiedprotein derivative ppd conjugated to singlewalled carbonnanotubes', ' immunol lett 200912648e53', 'parra j abadsomovilla a mercader jv et al', ' carbonnanotubeprotein carriers enhance sizedependentselfadjuvant antibody response to haptens', ' j controlrelease 2013170242e251', '61 schreiber ha prechl j jiang h et al', ' using carbon magneticnanoparticles to target track and manipulate dendritic cells', 'j immunol methods 201035647e59', '62 tkach av yanamala n stanley s et al', ' graphene oxide butnot fullerenes targets immunoproteasomes and suppressesantigen presentation by dendritic cells', ' small201391686e1690', '63 wang t zou m jiang h et al', ' synthesis of a novel kind ofcarbon nanoparticle with large mesopores and macroporesand its application as an oral vaccine adjuvant', ' eur j pharmsci 201144653e659', 'sy b merkle hp', ' particulate formulations64 hafner am corthefor the delivery of polyi c as vaccine adjuvant', ' adv drugdeliv rev 2013651386e1399', '65 sarti f perera g hintzen f et al', ' in vivo evidence of oralvaccination with plga nanoparticles containing theimmunostimulant monophosphoryl lipid a', ' biomaterials2011324052e4057', '66 luo z li p deng j et al', ' cationic polypeptide micellebasedantigen delivery system a simple and robust adjuvant toimprove vaccine efficacy', ' j control release 2013170259e267', '67 wilson jt keller s manganiello mj et al', ' phresponsivenanoparticle vaccines for dualdelivery of antigens andimmunostimulatory oligonucleotides', ' acs nano201373912e3925', '68 primard c poecheim j heuking s et al', ' multifunctionalplgabased nanoparticles encapsulating simultaneouslyhydrophilic antigen and hydrophobic immunomodulator formucosal immunization', ' mol pharm 2013102996e3004', '69 pawar d mangal s goswami r et al', ' development andcharacterization of surface modified plga nanoparticles fornasal vaccine delivery effect of mucoadhesive coating onantigen uptake and immune adjuvant activity', ' eur j pharmbiopharm 201385550e559', '70 marre s jensen kf', ' synthesis of micro and nanostructures inmicrofluidic systems', ' chem soc rev 2010391183e1202', '71 sebastian v arruebo m santamaria j', ' reaction engineeringstrategies for the production of inorganic nanomaterials', 'small 2013', ' epub', '72 gomez l sebastian v irusta s et al', ' scaledup production ofplasmonic nanoparticles using microfluidics from metalprecursors to functionalized and sterilized nanoparticles', 'lab chip 201414325e332', '', ''], 'Pegylation In Anti Cancer Therapy': ['asian journal of pharmaceutical sciences 11 2016 337348hosted byavailable online at www', 'sciencedirect', 'comsciencedirectjournal homepagewww', 'elsevier', 'comlocateajpsreviewpegylation in anticancer therapy an overviewprajna mishra a bismita nayak b r', 'k', ' dey acentre for applied chemistry central university of jharkhand ranchi 835 205 jharkhand indiadepartment of life science national institute of technology rourkela 769 008 odisha indiaarticleinfo', 'article historyadvanced drug delivery systems using polyethylene glycol peg is an important develreceived 1 july 2015opment in anticancer therapy', ' pegylation has the ability to enhance the retention time ofreceived in revised form 20 augustthe therapeutics like proteins enzymes small molecular drugs liposomes and nanoparticles2015by protecting them against various degrading mechanisms active inside a tissue or cell whichaccepted 26 august 2015consequently improves their therapeutic potential', ' pegylation effectively alters the pharavailable online 14 september 2015macokinetics pk of a variety of drugs and dramatically improves the pharmaceutical valuesrecent development of which includes fabrication of stimulisensitive polymerssmart polykeywordsmers and polymeric micelles to cope of with the pathophysiological environment of targetedpegsite with less toxic effects and more effectiveness', ' this overview discusses pegylation inpegylationvolving proteins enzymes low molecular weight drugs liposomes and nanoparticles thattargeted drug deliveryhas been developed clinically tried for anticancer therapy during the last decade', 'polymers 2016 the authors', ' production and hosting by elsevier b', 'v', ' on behalf of shenyang pharmaceutical university', ' this is an open access article under the cc byncnd licensehttpcreativecommons', 'orglicensesbyncnd4', '0', '1', '', '', 'cancer is one of the leading causes of death worldwide', ' metastases are the primary cause of death from cancer', ' cancercells proliferate at much faster rate than the normal cells', ' theavailable traditional cancer chemotherapy is not essentially selective as it depends on the kinetics of the cell growth', ' targetedcancer therapies are expected to be more effective and beneficiary in comparison to available conventional treatmentprocedures', 'the last few decades of research in the particular area arefocused on exploring the treatment of cancer at its molecular level', ' this will be helpful in developing better therapeutics', 'polymer therapeutics is establishing as an innovative andreliable method for its ability to conjugate with proteinenzymes nanoparticles liposomes and low molecular weightdrugs', ' in this regard polyethylene glycol peg a watersoluble and biocompatible polymer is the most commonly usednonionic polymer in the field of polymerbased drug delivery 1', ' passive targeting with pegs in combination with activetargeting entry into the tumor cell via ligand receptor antigenantibody interaction delivery systems has been effectively employed to achieve better therapeutic index of anticancer drugs', 'further with the introduction of stimuliresponsive chemical moiety in pegylated prodrugs the sensitiveness of the drugmolecule toward the pathophysiological environment of tumorcells in vivo evolved as a new era of sitespecific targeted drugdelivery system', ' hence this overview deals with the development and recent advancement in various aspects of pegylation corresponding author', ' centre for applied chemistry central university of jharkhand ranchi 835 205 jharkhand india', ' tel', ' 91 8987727378fax 916712306624', 'email address rkdeyrediffmail', 'com ratan', 'deycuj', 'ac', 'in r', 'k', ' dey', 'peer review under responsibility of shenyang pharmaceutical university', 'httpdx', 'doi', 'org10', '1016j', 'ajps', '2015', '08', '01118180876 2016 the authors', ' production and hosting by elsevier b', 'v', ' on behalf of shenyang pharmaceutical university', ' this is anopen access article under the cc byncnd license httpcreativecommons', 'orglicensesbyncnd4', '0', 'in cancer treatment and its future prospective in a comprehensive way', '2', 'pegylation and its significancethe technique of covalently attaching polyethylene glycol pegto a given molecule is known as pegylation and is now a wellestablished method in the field of targeted drug deliverysystems', ' the general structure of monomethoxy peg mpegcan be represented as ch3och2ch2onch2ch2oh', ' at thebeginning of peg chemistry in the late1970s professor frankdavis and his colleagues had shown that the immunologicalproperties as well as the stability of bovine serum albumin andbovine liver catalase can be successfully altered by covalently linking them to methoxy peg mpeg 23 using cyanuricchloride as an activating agent', ' the process of pegylation canbe extended to liposomes peptides carbohydrates enzymesantibody fragments nucleotides small organic molecules andeven to different nanoparticle formulations 48', ' mpeg is themost useful unit for polypeptide modification 9', ' now severalderivatives of peg molecules are available that vary in molecular weight and structure such as linear branched pegdendrimers and more recently multiarm pegs 9', ' the first stepof pegylation is to activate peg by conjugating a functional derivative of peg at one or both the terminals of peg chain', 'pegylation conjugation techniques can be classified into twocategories i firstgeneration random pegylation and ii secondgeneration sitespecific pegylation', ' thanks to the secondgeneration pegylation processes that resulted in welldefinedconjugated products with improved product profiles over thoseobtained through nonspecific random conjugations', 'pegspacerlinkerdrugirreversibly conjugating pegs had some adverse effects onthe specific biological activity of many therapeutics', ' thus tominimize the loss of activity a reversible or releasable prodrugpegylation concept has been formulated', ' reversible pegylationconcept deals with attachment of drugs to peg derivativesthrough cleavable linkages fig', ' 1', ' the release of drug occursby therapeutic agents through enzymatic hydrolytic cleavage or reduction in vivo at a predetermined kinetic rate overa time period 10', 'the objective of most peg conjugation techniques aims atincreasing the circulation halflife without affecting activity', 'it is to be noted that the distinct advancement in the peg conjugation processes and diversity in the nature of the pegs usedfor the conjugation has attributed to the increased demand forpegylated pharmaceutical products', 'pegylation enhances the therapeutic efficacy of the drugsby bringing in several advantageous modifications over the nonpegylated products', ' the systematic classification is illustratedin fig', ' 2', ' increase in the serum halflife of the conjugate is themajor way of enhancing therapeutic potential of the pegylatedconjugate', ' pegylation prolongs the circulation time of conjugated therapeutics by increasing its hydrophilicity and reducingthe rate of glomerular filtration 1112', ' few factors such as protection from reticuloendothelial cells proteolytic enzymes anddecreased formation of neutralizing antibodies against theprotein by masking antigenic sites by formation of a protective hydrophilic shield are the key components of peg moleculethat attributes to the improved pharmacokinetic profile pkof the conjugates 1316', ' it has also been reported thatpegylation increases the absorption halflife of subcutaneously administered agents and is associated with a decreasedvolume of distribution 11', ' peg is a nonbiodegradable polymerthat puts limits on its use', ' it has been shown that pegs upto molecular weight 20 kda is primarily excreted through therenal system whereas higher molecular weight peg chains geteliminated by fecal excretion 17', ' pegylation proved to be themost promising approach for increasing the serum halflife ofthe conjugated therapeutics which is related to enhancement of efficacy of the conjugate', ' however pegylation imposescertain disadvantages on liposomes especially for the delivery of genes and nucleic acids in anticancer therapy as itssurface hydrophilic shield reduces the cellular uptake and improves the stability of the lipid envelope and the process resultsin poor endosomal escape via membrane fusion and degradation of cargos in lysosomes 1819', ' hence the use of peg ingene and nucleic acid delivery to cancer cell is referred to aspeg dilemma 20', ' the issue can be efficiently addressed bydesigning phsensitive and tumorspecific targeted pegylatedtherapeutics 2123', '2', '1', 'drugsrole of pegylation in passive and active targeting ofpassive targeting drug delivery technique as illustrated in fig', ' 3mostly depends upon the concentration gradient between theintracellular and extracellular space created due to high concentration of the drug in the tumor area 24', ' peg conjugatestakes the advantage of enhanced permeation and retentionepr effect executed by the tumors and gets accumulated inthe pathophysiological environment of tumor vessels throughleaky vasculature and poor lymphatic drainage', ' however thiseffect cannot be studied with low molecular weight drugs thatfreely extravagate causing systemic toxicity and this is a sizedependent effect', ' pegylation increases the solubility sizemolecular mass and serum stability of the drugs', ' for all thesereasons pegylation is considered to be one of the best methodsfor passive targeting of anticancer therapeutics', 'the concept of active targeting of drugs is based on the ideaof conjugating drug molecules to targeting entities antibodies ligands etc', ' for specific interaction with the structurespresent on the cell surface for targeted delivery of the anticancer agent 2526', ' the fate of the prodrug is dictated bythe targeting molecule and the linker molecule present on theprodrug', ' the targeting moiety essentially decides the type ofcancer cell for the act of therapeutics', ' further depending onthe linker molecule the drug gets entry into the tumor cell byeither of the two ways i receptormediated internalizationof the whole prodrug by endocytosis and subsequent degradation by endosomallysosomal pathway fig', ' 4 or ii receptorindependent internalization of the drug into targeted cells afterextracellular cleavage of the prodrug fig', ' 5 27', ' pegylatedprodrugs can be efficiently conjugated to targeting moietiesby different conjugation chemistry in order to achieve the goalof active targeting', ' the targeted delivery of the pegylated drugsat the desired site causes high bioavailability and low systemic toxicity', '3', 'pegylated proteins in anticancer therapypegylation of proteins is a wellestablished method in the pharmaceutical field but the significance of pegylated peptides andproteins for anticancer therapy has only been realized in thelast several years as more and more peg conjugates make itto latephase clinical trials', ' enzymes monoclonal antibodiesand cytokines are the three major class of proteins used in anticancer therapy or as adjuvant therapypegylated monoclonal antibody fragmentin the field of anticancer therapy monoclonal antibodies represent the major class of protein therapeutics', ' antibodies actby binding to the specific antigenscell surface receptors', ' thistask is taken care by the fragment antigenbinding fab regionon an antibody', ' depending upon the receptor and the bindingsite on the receptor against which the antibody is designedit can either activate cellular signaling pathways leading toapoptosis cell growth arrest or block the pathways leading tocell growth that eventually causes tumor cell death apoptosis', ' this event is illustrated pictorially in fig', ' 6', ' the majordrawback associated with fabs antibody fragment is its shortserum halflife as it lacks the fc region of the antibody thatlimits its potential as a therapeutic agent', ' hence suitablepegylation methods and pegs are used to ensure minimal lossof the antibodyantigencell surface receptor interaction keepingin view the enhancement of serum halflife', ' it has been reported that the hinge region cysteine residues on immunoglobulin g igg antibody isotype fab antibody fragments cantolerate attachment of one or two peg moieties up to a totalof 40 kda molecular weight with little effect on antigen bindingaffinity', ' this process also enables significant increase in thehalflife of the circulating plasma antibodies by reducing thefda approved dateclinical trial status and usemarch 9 2011 approved as adjuvant therapy for resected stage iiimelanomaphase i for melanoma and phase ii as for chronic myelogenous leukemia2002 to treat neutropenia during chemotherapyfebruary 1994 acute lymphoblastic leukemia and in july 24 2006 firstlinetreatment for acute lymphoblastic leukemiafig', ' 6  a igg full length antibody and b pegylated igg fab antibody fragmentcell surface receptor interaction and itsoutcome', 'glomerular filtration and lower immunogenicity than the parentigg 28', 'the example of use of pegantibody fragment angiogenesis inhibitor cdp791 is illustrated as follows cdp791pegylated difab antibody fragment antagonizes the effect ofvascular endothelial growth factor receptor2 vegfr2 whichis a prominent angiogenesis stimulatory molecule responsible for tumor progression', ' the short plasma halflife of theunmodified cdp791 antibody fragment which lacks fc regionhas a low molecular weight and responsible for low therapeutic index', ' pegylation of the cysteine amino acid present at thecterminus of the native antibody could be able to resolve thisissue by reducing its kidney clearance', ' this is demonstratedby the clinical studies for patients with colorectal ovarian renalcancer or other tumors 29', '3', '2', 'pegylated cytokinescytokines represent another class of protein therapeutics employed mainly as adjuvant therapy in classical anticancerchemotherapy protocols either to control or bring improvements in patient conditions', ' these small secreted proteinsbelong to the immunotherapy category and mobilizes the bodysimmune system to fight cancer', ' the process is illustrated pictorially in fig', ' 7', '3', '2', '1', 'peginterferonalpha conjugatesthis process is illustrated as peginterferonα2b pegintronsylatron and peginterferonα2a pegasys which arediscussed as follows3', '2', '1', '1', ' peginterferonα2b pegintronsylatron', ' thepegylated version of interferonα2b was synthesized by conjugating interferonα2b with a single chain 12 kda pegsc viaa urethane bond 30', ' it displayed a halflife of 2737 h with10fold lower clearance and minor change in the volume of distribution in comparison to native form 31', ' based upon theoutcome of clinical studies in the year 2011 the pegylated drugpeginterferon alfa2b pegifn got fda approval for adjuvant treatment of melanoma patients with microscopic or gross342asian journal of pharmaceutical sciences 11 2016 337348fig', ' 7  representing pegylated cytokines in anticancer therapy', 'nodal involvement following definitive surgical resection including complete lymphadenectomy 32', ' sylatron is anotherbrand name for peginterferon alfa2b exclusively approved byfda for adjuvant therapy in cancer treatment', '3', '2', '1', '2', ' peginterferonα2a pegasys', ' another pegylated interferon pegasys is prepared by monopegylation ofinterferonα2a with an nhydroxysuccinimide nhs activated 40 kda branched peg molecule 33', ' pegylation prolongedthe serum halflife from 3', '8 to 65 h slowing down the clearance by more than 100fold', ' this has also reduced the volumeof distribution to fivefold with respect to the native interferonα2b 31', ' pegasys was efficient in improving the patientcompliance by enabling onceweekly dosing while maintaining acceptable safety tolerability and activity profiles in clinicalstudies 34', ' currently pegasys is under evaluation as adjuvant therapy for patients with intermediate and highriskmelanomas 35', '3', '2', '2', ' peggranulocyte colony stimulating factorpegfilgrastimpegfilgrastim was synthesized by conjugating a linear 20 kdampegaldehyde derivative to an nterminal methionine residueof filgrastim through reductive alkylation under mild acidic conditions 3637', ' it is to be noted that a single dose of pegfilgrastim per chemotherapy cycle could be able to reduce therisk of febrile neutropenia significantly with respect to the nativeprotein 11 vs', ' 19 3840', ' currently pegylatedgcsfpegfilgastrim neulasta is used as an adjuvant therapy forpatients with nonmyeloid malignancies receiving myelosuppressive chemotherapy bone marrow suppression as a sideeffect of chemotherapy associated with a 20 risk of febrileneutropenia 4142', '3', '3', 'pegylated enzymes in anticancer therapytherapeutic enzymes represent a growing class of biopharmaceuticals and pegylation has played a major role inimproving several of these products 43', ' many depletingenzymes are active against tumors', ' enzymes intrinsic property of degrading amino acids is essential for cancer cellsexistence', ' the fate of the tumor cell is dictated by the different cellular pathways regulated by the substrate amino acidto be degraded and the process of degradation is illustratedin fig', ' 8', ' the normal cells are not affected because the normalcells can synthesize the amino acids for their growth', ' this situation is particularly the most advantageous aspect of usingdepleting enzymes in cancer therapy table 1', ' therefore duringpegylation procedure a combination of these enzymes lowmolecular weight 510 kda pegs and random amine conjugation strategies are employed', '3', '3', '1', 'pegarginine depleting enzymesarginine is a nonessential amino acid in humans', ' it has beenreported that arginine deficiency inhibits tumor growth angiogenesis and nitric oxide synthesis 44', ' two types of argininedegrading enzymes i', 'e', ' i arginine deiminase adi and ii arginase arg which can be utilized as antitumor agents arediscussed below3', '3', '1', '1', ' pegarginine deiminase', ' the pegylation of argininedeiminase proved to be a better therapeutic approach foranticancer treatment', ' among the several pegylated adi formulations the adipeg20000 formulated by conjugating1012 chains of 20 kda peg with adi by using the succinimidylsuccinate linker is proved to be the acceptable one fromin vivo study results 45', ' clinical studies have shown better efficacy of adi peg 200000 in terms of antitumor activity andtolerability 4647', ' currently adi peg 200000 versus placebois under phase iii clinical trial for advanced hepatocellular carcinoma', ' further phase ii for acute myeloidleukemianonhodgkins lymphoma and phase i for metastatic melanoma in combination with cisplatin for solidtumors in combination with docetaxel are under trial48', 'asian journal of pharmaceutical sciences 11 2016 337348343fig', ' 8  representing pegylated depleting enzymes in anticancer therapy', '3', '3', '1', '2', ' pegarginase', ' the depleting enzyme arginase is an endogenous protein expressed in humans', ' the conjugate pegrharg has 10 to 12 polymer chains of peg 5000 per proteinmolecule that is covalently attached via a succinamide propionic acid spa linker', ' this conjugate remains in fully activecondition 49', ' the pegylated form executes sufficient catalytic activity at physiological ph with a prolonged plasma halflife of 3 days in comparison to the native form which has ahalflife of several minutes only', ' currently this conjugate isunder phase iii clinical trials', '3', '3', '2', ' pegasparagine depleting enzymepeglasparaginasedepletion of asparagine eventually results in leukemic celldeath', ' leukemic cells lack the enzyme asparagine synthetase an enzyme required for asparagine synthesis and dependon the exogenous supply of asparagine for their growth andsurvival', ' therefore asparaginase the depleting enzyme for asparagine plays a critical role as a therapeutic enzyme in treatingacute lymphoblastic leukemia all', ' oncaspar is a modifiedform of the enzyme lasparaginase approved by fda in 1994', 'oncaspar consists of tetrameric enzyme lasparaginase derivedfrom e', ' coli and it is covalently conjugated with approximately 6982 molecules of monomethoxy polyethylene glycolmpeg each having molecular weight of 5 kda 50', ' oncasparproved to be a better treatment option for patients who wereallergic to the native form of the drug', ' the u', 's', ' food and drugadministration granted approval to pegaspargase oncasparenzon pharmaceuticals inc in july 2006 for the firstline treatment of patients with acute lymphoblastic leukemia all asa component of a multiagent chemotherapy regimen 51', '4', 'pegylated low molecular weightanticancer drugsvarious pegylated low molecular weight anticancer drugs arecurrently under development', ' for example topoisomerase i inhibitor camptothecinbased drugs irinotecan topotecan sn38exetecan etc', ' is reported to be useful in the treatment of manysolid tumors', ' however the hydrophobicity of such materiallimits their therapeutic efficacy', ' few of the examples listed intable 2 are discussed below4', '1', 'pegsn38 ezn2208ezn2208 the product enzon pharmaceuticals inc is apegylated sn38 10hydroxy7ethylcamptothecin a derivative of camptothecin', ' sn38 is the active moiety of cpt11camptosar irinotecan and reported to be a potenttopoisomerase i inhibitor', ' in this pegylated product the 20oh group of sn38 was selectively coupled with a 4 arm pegof 40 kda through a glycine spacer to preserve the e ring ofsn38 in the active lactone form while leaving the drug 10ohfree 52', ' pegylation was able to enhance the solubility of sn38by about 1000fold', ' in fact ezn2208 showed a 207fold higherexposure to sn38 compared to irinotecan in treated mice 53', 'the conjugate showed promising antitumor activity both in vitroand in vivo', ' however following phase ii trial enzon pharmaceuticals inc', ' announced the discontinuance of its ezn2208clinical program 54', '4', '2', 'pegirinotecan nktr102 etirinotecan pegolnktr102 was developed by nektar therapeutics as a pegylatedformulation for the treatment of colorectal cancer and othersolid tumors using the architecture of new multiarm pegs', ' itis the first longacting topoisomerase i inhibitor', ' it is synthesized by covalently conjugating irinotecan to a fourarm peg55', ' sn38 10hydroxy7ethylcamptothecin a derivative ofcamptothecin is the active metabolite of nktr102', ' it is reported in both phase i and ii studies for nktr102 thatsustained exposure of the active drug was associated withpromising antitumor activity 5658', ' currently nktr102 isin phase iii clinical trial for patients with metastatic or locallyrecurrent breast cancer and phase ii clinical trial for patientswith solid tumor malignancies that include ovarian colorectalsmall cell and nonsmall cell lung cancers 59', '5', 'pegylated nanoparticles in anticancertherapynanoparticles nps are synthetic materials with dimensionsfrom 1 to 1000 nanometers', ' nps have large payloads stability and the capacity for multiple simultaneous applicationsdue to their unique size and high surface areavolume ratio60', ' despite these advantages the major drawbacks associated with np drug delivery system for clinical studies areassociated with short circulating halflife due to uptake by thereticuloendothelial system res for larger nps whereas smallernps are subjects to tissue extravazations and renal clearance61', ' liposomes solid lipids nanoparticles dendrimers polymers silicon or carbon materials and gold and magneticnanoparticles are examples of nanocarriers that have beenstudied as drug delivery systems in cancer therapy', ' therefore surface modification of the nanoparticles with pegs ofvarious chain length shape density molecular weight and incorporation of different targeting moieties ligands antibodiesetc', ' is emerging as a more promising and technologically advanced drug delivery system in anticancer therapy 6264', 'there are currently more than 35 us fdaapproved pegylatednps with a larger number in preclinical studies for both imagingand therapy 8', ' among several pegylated nanoparticle formulations for anticancer therapy liposomes have been mostextensively studied', '5', '1', 'pegylated liposomes in anticancer therapyliposomes are spherical selfclosed structures formed by oneor more concentric lipid bilayers with an encapsulated aqueousphase in the center and between the bilayers composed ofnatural or synthetic lipids 65', ' the development of longcirculating liposomes with inclusion of the synthetic polymerpolyethylene glycol peg in liposome composition could beable to solve the issue of low serum halflife associated withliposomes', ' peg can be incorporated on the liposomal surfacein a number of ways', ' however anchoring the polymer inthe liposomal membrane via a crosslinked lipid pegdistearoylphosphatidylethanolamine dspe is reported to bethe most widely accepted method 6667', ' preclinical studieswith pegylated liposomes reported that the cytotoxic agentsentrapped in pegylated liposomes tend to accumulate in tumors68', ' however recent preclinical studies of anticancer drug enclosed in pegylated liposomes in rodents and dogs have shownthe rapid blood clearance of the pegylated drug carrier systemdue to the increased antipegigm production 6970', ' anexample of pegylated liposomal formulations pegylated liposomal doxorubicin pld and most extensively studied isdiscussed below5', '1', '1', 'doxil pegylated liposomal doxorubicindoxil is the trade name for pegylated liposomal doxorubicin formulated to achieve better drug efficacy for cancerchemotherapy', ' this product contains doxorubicin adriamycinenclosed in an 8090 nm size unilamellar liposome coated withpeg', ' the modification increases the circulatory halflife of thedrug leading to its enhanced bioavailability at the tumor site7172', ' pegylated liposomal doxorubicin has fewer side effectson healthy cells than regular doxorubicin 7374', ' pld has improved pharmacokinetic features such as long circulation timeof about 6090 h for doses in the range of 3570 mgm2 in patients with solid tumors', ' after pld administration nearly 100of the drug in the plasma remains in the encapsulated form', 'moreover in comparison to free doxorubicin pld plasma clearance is dramatically slower and its volume of distributionremains very small which is roughly equivalent to the intravascular volume 7577', ' after obtaining approval from fdapegylated liposomal doxorubicin pld doxilcaelyx is currently used to treat kaposis sarcoma and recurrent ovariancancer table 2', '6', 'pegylated smart polymers in anticancertherapysmart polymers are defined as polymers that undergo reversible large physical or chemical changes in response to smallexternal changes in the environmental conditions such as temperature ph light magnetic or electric field ionic factorsbiological molecules etc', ' smart polymers show promising applications in the biomedical field as delivery systems oftherapeutic agents 78', ' among various smart polymers currently in use in biomedical field of research the temperaturesensitive systems are the most studied systems', ' the greatertherapeutic index of the targeted drug delivery systems canasian journal of pharmaceutical sciences 11 2016 337348be achieved by adjusting the transition temperature tt of thermally responsive polymers i', 'e', ' between body temperature37 c and the temperature approved for mild clinical hyperthermia 42 c 79', ' within the temperature ranges thesepolymers facilitate tissue accumulation by localizing the aggregation of systemically delivered carriers to the heated tumorvolume 8081', ' for example thermodox a temperaturesensitive doxorubicinloaded pegylated liposome dppcreleases encapsulated doxorubicin at elevated tissue temperature', ' dppc has a transition temperature of 41', '5 c which makesit suitable for temperaturesensitive technology 82', ' the temperature can be achieved by radiofrequency ablation technique', 'for thermodox the concentration of the drug is up to 25 timesmore in the treatment area than iv doxorubicin and severalfold the concentration of other liposomally encapsulated doxorubicins 8283', ' currently it is under phase iii clinical trial forhepatocellular carcinoma table 2', '7', 'pegylated polymeric micelles in anticancer therapypolymeric micelles are colloidal dispersions prepared by blockcopolymers consisting of hydrophilic and hydrophobicmonomer units', ' selfassembling amphiphilic polymeric micelles represents an efficient drug delivery system for poorlysoluble or insoluble drugs 84', ' different varieties of amphiphilic polymeric micelles i', 'e', ' diblock ab type triblock aba typeor graft copolymers can be designed by arranging the monomeric units in different ways and orders 8586', ' thehydrophobic block constitute the core and the hydrophilic blockmakes the corona of the micelles', ' the watersoluble peg blockswith a molecular weight from 1 to 15 kda are considered asthe most suitable hydrophilic coronaforming blocks 87', ' variouspreclinical and clinical studies have shown the potential useof pegylated polymeric micelles with different hydrophobicblocks such as plga polydllactidecoglycolide 8890 polyaspartate 91 γbenzyllglutamate 92 polyglutamate pglu93 and polydllactic acid 94 in anticancer therapy', ' it isto be noted that five different pegylated polymeric micellar formulations as enlisted in table 3 are currently under clinicaltrials for possible anticancer treatment 9596', '8', 'pegylated nanoparticles for sirna deliveryin anticancer therapyrna interference is a natural phenomenon employed to selectively turn off the genes expressed in some diseases', '345molecular therapy using small interfering rna sirna hasshown great therapeutic potential for tumors and other diseases caused by abnormal gene overexpression or mutation', 'it is a highly specific process for gene silencing', ' however nakedmolecules of sirna are vulnerable to premature renal clearance and nuclease degradation', ' the negative charge andhydrophilicity of sirna also limit its permeability through cellular and endolysosomal membranes', ' therefore in order toovercome these issues sirna requires a carrier system for effective delivery 97', ' modification of drug delivery systems withpegs of suitable chain length molecular weight and percentcomposition was proven to be efficient in overcoming intracellular and systemic sirna delivery barriers 98', ' calla 01a nanoparticle formulation calando pharmaceuticals formulated by using cyclodextrin nanoparticles conjugated totransferrin and coated with peg is the first one to enter underphase i clinical trials for solid tumors 4499 in addition to fewmore which are currently under development table 2', '9', 'conclusionspegylation offers a great advantage for bioactive molecules inpharmaceutical and biological applications by way of reducing protein immunogenicity and increased serum halflife ofthe drugs', ' this overview highlighted on the use of pegylatedproteins low molecular weight drugs and peg micelles', 'pegylation improves the therapeutic efficacy of a drug bypassive targeting in a novel way', ' the process can also be combined effectively with active targeting and stimuliresponsivetargeted therapies for the development of new methodologies for the treatment of cancer', ' it is important to note thatthe efficacy of pegylated drugs depends on overall exposureand its relationship to the pharmacodynamics of the drug', ' molecular weight of peg chain and its structural modificationscarries strategic importance for conjugation with drug molecule for effective pegylation process', ' the research in thisdirection shall be helpful in effective cancer treatment processin near future', '', '', '', 'the authors wish to acknowledge dr', ' rajakishore mishra fromcentral university jharkhand india and dr', ' basabi rana fromloyola university chicago usa for their valuable suggestions', 'the grant in aid from dst new delhi project no', ' srs1pc242009 is duly acknowledged', ' university fellowship to prajnamishra for pursuing her research work is acknowledged', '', '1 knop k hoogenboom r fischer d et al', ' polyethyleneglycol in drug delivery pros and cons as well as potentialalternatives', ' angew chem int ed engl 20104962886308', '2 abuchowski a van es t palczuk nc et al', ' alteration ofimmunological properties of bovine serum albumin bycovalent attachment of polyethylene glycol', ' j biol chem197725235783581', '3 abuchowski a mccoy jr palczuk nc et al', ' effect of covalentattachment of polyethylene glycol on immunogenicity andcirculating life of bovine liver catalase', ' j biol chem197725235823586', '4 immordino ml dosio f cattel l', ' stealth liposomes reviewof the basic science rationale and clinical applicationsexisting and potential', ' int j nanomedicine 20061297315', '5 matsushima a kodera y hiroto m et al', ' bioconjugates ofproteins and polyethylene glycol potent tools inbiotechnological processes', ' j mol catal b enzym 19962117', '6 eugenia giorgi m agusti r de lederkremer beilstein rm', 'carbohydrate pegylation an approach to improvepharmacological potency', ' j org chem 20141014331444', '7 riley t riggssauthier j', ' the benefits and challenges ofpegylating small molecules', ' pharm technol 2008328894', '8 jokerst jv lobovkina t zare rn et al', ' nanoparticlepegylation for imaging and therapy', ' nanomedicine20116715728', '9 roberts mj bentley md harris jm', ' chemistry for peptideand protein pegylation', ' adv drug deliv rev 200254459476', '10 veronese fm pasut g', ' pegylation posttranslationalbioengineering of protein bio therapeutics', ' drug discovtoday technol 200855764', '11 caliceti p veronese fm', ' pharmacokinetic and biodistribution properties of polyethylene glycol proteinconjugates', ' adv drug deliv rev 20035512611277', '12 bhat r timasheff sn', ' steric exclusion is the principalsource of the preferential hydration of proteins in thepresence of polyethylene glycols', ' protein sci 1992111331143', '13 bailon p berthold w', ' polyethylene glycolconjugatedpharmaceutical proteins', ' pharm sci technol today19981352356', '14 monfardini c schiavon o caliceti p et al', ' a branchedmonomethoxypoly ethylene glycol for proteinmodification', ' bioconjug chem 199566269', '15 delgado c francis ge fisher d', ' the uses and properties ofpeg linked proteins', ' crit rev ther drug carrier syst19929249304', '16 nucci ml shorr r abuchowski a', ' the therapeutic value ofpolyethylene glycolmodified proteins', ' adv drug deliv rev19916133151', '17 yamaoka t tabata y ikada y', ' distribution and tissueuptake of polyethylene glycol with different molecularweights after intravenous administration to mice', ' j pharmsci 199483601606', '18 mishra s webster p davis me', ' pegylation significantlyaffects cellular uptake and intracellular trafficking of nonviral gene delivery particles', ' eur j cell biol 20048397111', '19 remaut k lucas b braeckmans k et al', ' pegylation ofliposomes favours the endosomal degradation of thedelivered phosphodiester oligonucleotides', ' j control release2007117256266', '20 hatakeyama h akita h harashima h', ' thepolyethyleneglycol dilemma advantage and disadvantage ofpegylation of liposomes for systemic genes and nucleicacids delivery to tumors', ' biol pharm bull 201336892899', '21 sato y hatakeyama h sakurai y et al', ' a phsensitivecationic lipid facilitates the delivery of liposomal sirna andgene silencing activity in vitro and in vivo', ' j control release2012163267276', '22 hatakeyama h akita h harashima h', ' a multifunctionalenvelope type nano device mend for gene delivery totumours based on the epr effect a strategy for overcomingthe peg dilemma', ' adv drug deliv rev 201163152160', '23 hatakeyama h akita h kogure k et al', ' development of anovel systemic gene delivery system for cancer therapy witha tumorspecific cleavable peglipid', ' gene ther 2007146877', '24 seymour lw miyamoto y maeda h et al', ' influence ofmolecular weight on passive tumour accumulation of asoluble macromolecular drug carrier', ' eur j cancer199531a766770', '25 schrama d reisfeld ra becker jc', ' antibody targeted drugsas cancer therapeutics', ' nat rev drug discov 20065147159', '26 allen tm', ' ligandtargeted therapeutics in anticancertherapy', ' nat rev cancer 20022750763', '27 banerjee ss aher n patil r et al', ' polyethyleneglycolprodrug conjugates concept design and applications', ' jdrug deliv 20122012article id 103973', '28 chapman ap', ' pegylated antibodies and antibody fragmentsfor improved therapy a review', ' adv drug deliv rev200254531545', '29 ton nc parker gj jackson a et al', ' phase i evaluation ofcdp791 a pegylated difab conjugate that binds vascularendothelial growth factor receptor 2', ' clin cancer res20071371137118', '30 wang ys youngster s grace m et al', ' structural andbiological characterization of pegylated recombinantinterferon alpha2b and its therapeutic implications', ' advdrug deliv rev 200254547570', '31 zeuzem s welsch c herrmann e', ' pharmacokinetics of peginterferons', ' semin liver dis 2003232328', '32 herndon tm demko sg jiang x et al', ' peginterferonalfa2bfor the adjuvant treatment of patients with melanoma', 'oncologist 20121713231328', '33 reddy kr modi mw pedder s', ' use of peginterferon α2a40kd pegasys for the treatment of hepatitis c', ' adv drugdeliv rev 200254571586', '34 lipton jh khoroshko n golenkov a et al', ' pegasys cmlstudy group', ' phase ii randomized multicenter comparativestudy of peginterferonalpha2a 40kd pegasys versusinterferon alpha2a roferona in patients with treatmentnaïve chronicphase chronic myelogenous leukemia', ' leuklymphoma 200748497505', '35 loquai c nashan d hensen p et al', ' safety of pegylatedinterferonalpha2a in adjuvant therapy of intermediate andhighrisk melanomas', ' eur j dermatol 2008182935', '36 veronese fm mero a', ' the impact of pegylation on biologicaltherapies', ' biodrugs 200822315329', '37 kinstler o molineux g treuheit m et al', ' mononterminalpolyethylene glycolprotein conjugates', ' adv drug deliv rev200254477485', '38 green md koelbl h baselga j et al', ' a randomized doubleblind multi center phase iii study of fixeddose singleadministration pegfilgrastim versus daily filgrastim inpatients receiving myelosuppressive chemotherapy', ' annoncol 2003142935', '39 holmes fa jones se oshaughnessy j et al', ' comparableefficacy and safety profiles of oncepercycle pegfilgrastimand daily injection filgrastim in chemo therapyinducedneutropenia a multi center dosefinding study in womenwith breast cancer', ' ann oncol 200213903909', '40 grigg a solalceligny p hoskin p et al', ' openlabelrandomized study of pegfilgrastim vs', ' daily filgrastim as anadjunct to chemotherapy in elderly patients with nonhodgkins lymphoma', ' leuk lymphoma 20034415031508', 'vogel cl wojtukiewicz mz carroll rr et al', ' first andsubsequent cycle use of pegfilgrastim prevents febrileneutropenia in patients with breast cancer a multi centerdoubleblind placebocontrolled phase iii study', ' j clin oncol20052311781184', 'smith tj khatcheressian j lyman gh et al', ' update ofrecommendations for the use of white blood cell growthfactors an evidencebased clinical practice guideline', ' j clinoncol 20062431873205', 'vellard m', ' the enzyme as drug application of enzymes aspharmaceuticals', ' curr opin biotechnol 200314444450', 'cheng pn leung yc lo wh et al', ' remission ofhepatocellular carcinoma with arginine depletion inducedby systemic release of endogenous hepatic arginase due totrans hepatic arterial embolisation augmented by highdoseinsulin arginase as a potential drug candidate forhepatocellular carcinoma', ' cancer lett 20052246780', 'holtsberg fw ensor cm steiner mr et al', ' polyethyleneglycol peg conjugated arginine deiminase effects of pegformulations on its pharmacological properties', ' j controlrelease 200280259271', 'glazer es piccirillo m albino v et al', ' phase ii study ofpegylated arginine deiminase for non resectable andmetastatic hepatocellular carcinoma', ' j clin oncol20102822202226', 'ascierto pa scala s castello g et al', ' pegylated argininedeiminase treatment of patients with metastatic melanomaresults from phase i and ii studies', ' j clin oncol20052376607668', 'httpsclinicaltrials', 'gov', 'cheng pn lam t lam w et al', ' pegylated recombinanthuman arginase rhargpeg5000mw inhibits the in vitro andin vivo proliferation of human hepatocellular carcinomathrough arginine depletion', ' cancer res 200767309317', 'pillai g', ' nanomedicines for cancer therapy an update offda approved and those under various stages ofdevelopment', ' soj pharm pharm sci 201412113', 'dinndorf pa gootenberg j cohen mh et al', ' fda drugapproval summary pegaspargase oncaspar for the firstline treatment of children with acute lymphoblasticleukemia all', ' oncologist 200712991998', 'zhao h rubio b sapra p et al', ' novel prodrugs of sn38 usingmulti arm polyethylene glycol linkers', ' bioconjug chem200819849859', 'sapra p zhao h mehlig m et al', ' novel delivery of sn38markedly inhibits tumor growth in xenografts including acamptothecin11refractory model', ' clin cancer res20081418881896', 'httpenzon', 'compostsview42', 'hoch u staschen cm johnson rk et al', ' nonclinicalpharmacokinetics and activity of etirinotecan pegol nktr102 a longacting topoisomerase 1 inhibitor in multiplecancer models', ' cancer chemother pharmacol 20147411251137', 'jameson gs hamm jt weiss gj et al', ' a multicenter phasei doseescalation study to assess the safety tolerability andpharmacokinetics of etirinotecan pegol in patients withrefractory solid tumors', ' clin cancer res 201319268278', 'vergote ib garcia a micha j et al', ' randomized multicenterphase ii trial comparing two schedules of etirinotecan pegolnktr102 in women with recurrent platinumresistantrefractory epithelial ovarian cancer', ' j clin oncol20133140604066', '58 awada a garcia aa chan s et al', ' two schedules ofetirinotecan pegol nktr102 in patients with previouslytreated metastatic breast cancer a randomised phase 2study', ' lancet oncol 20131412161225', '59 httpwww', 'nektar', 'com', '60 jain pk huang x elsayed ih et al', ' noble metals on thenanoscale optical and photo thermal properties and someapplications in imaging sensing biology and medicine', ' accchem res 20084115781586', '61 cole aj yang vc david ae', ' cancer theranostics the rise oftargeted magnetic nanoparticles', ' trends biotechnol201129323332', '62 cruza lj tackena pj fokkinkb r et al', ' the influence of pegchain length and targeting moiety on antibodymediateddelivery of nanoparticle vaccines to human dendritic cells', 'biomaterials 20113267916803', '63 bao w liu r wang y et al', ' plgapllpegtfbased targetednanoparticles drug delivery system enhance antitumorefficacy via intrinsic apoptosis pathway', ' int j nanomedicine201510557566', '64 zhang f zhang s pollack sf et al', ' improving paclitaxeldelivery in vitro and in vivo characterization of pegylatedpolyphosphoesterbased nanocarriers', ' j am chem soc201513720562066', '65 pisal ds kosloski mp baluiyer sv', ' delivery of therapeuticproteins', ' j pharm sci 20109925572575', '66 allen tm hansen c martin f et al', ' liposomes containingsynthetic lipid derivatives of polyethylene glycol showprolonged circulation halflives in vivo', ' biochim biophysacta 199110662936', '67 allen c dos sn gallagher r et al', ' controlling the physicalbehavior and biological performance of liposomeformulations through use of surface grafted polyethyleneglycol', ' biosci rep 200222225250', '68 newman ms colbern gt working pk et al', ' comparativepharmacokinetics tissue distribution and therapeuticeffectiveness of cisplatin encapsulated in longcirculatingpegylated liposomes spi 077 in tumorbearing mice', 'cancer chemother pharmacol 19994317', '69 yang q ma y zhao y et al', ' accelerated drug release andclearance of pegylated epirubicin liposomes followingrepeated injections a new challenge for sequential lowdosechemotherapy', ' int j nanomedicine 2013812571268', '70 suzuki t ichihara m hyodo k et al', ' accelerated bloodclearance of pegylated liposomes containing doxorubicinupon repeated administration to dogs', ' int j pharm2012436636643', '71 krown se northfelt dw osoba d et al', ' use of liposomalanthracyclines in kaposis sarcoma', ' semin oncol2004313652', '72 lao j madani j puértolas t et al', ' liposomal doxorubicin inthe treatment of breast cancer patients a review', ' j drugdeliv 20132013article id 456409', '73 rahman am yusuf sw ewer ms', ' anthracyclineinducedcardiotoxicity and the cardiac sparing effect of liposomalformulation', ' int j nanomedicine 20072567583', '74 obrian me wigler n inbar m et al', ' reduced cardiotoxicityand comparable efficacy in a phase iii trial of pegylatedliposomal doxorubicin hcl caelyxdoxil versusconventional doxorubicin for firstline treatment ofmetastatic breast cancer', ' ann oncol 200415440449', '75 gabizon a', ' applications of liposomal drug delivery systemsto cancer therapy', ' in nanotechnology for cancer therapy', 'new york crc press 2006', ' p', ' 595611', '76 gabizon a catane r uziely b et al', ' prolonged circulationtime and enhanced accumulation in malignant exudates ofdoxorubicin encapsulated in polyethyleneglycol coatedliposomes', ' cancer res 199454987992', '348asian journal of pharmaceutical sciences 11 2016 33734877 amantea ma forrest a northfelt dw et al', ' populationpharmacokinetics and pharmacodynamics of pegylatedliposomal doxorubicin in patients with aidsrelatedkaposis sarcoma', ' clin pharmacol ther 199761301311', '78 aguilar mr elvira c gallardo a et al', ' smart polymers andtheir applications as biomaterials', ' top tissue eng 20073127', '79 jones e thrall d dewhirst mw et al', ' prospective thermaldosimetry the key to hyperthermias future', ' int jhyperthermia 200622247253', '80 meyer de kong ga dewhirst mw et al', ' targeting agenetically engineered elastinlike polypeptide to solidtumors by local hyperthermia', ' cancer res 20016115481554', '81 zhang j chen h xu l et al', ' the targeted behavior ofthermally responsive nano hydrogel evaluated by nirsystem in mouse model', ' j control release 20081313440', '82 slingerland m guchelaar hj gelderblom h', ' liposomal drugformulations in cancer therapy 15 years along the road', 'drug discov today 201217160166', '83 yarmolenko ps zhao y landon c et al', ' comparative effectsof thermo sensitive doxorubicincontaining liposomes andhyperthermia in human and murine tumors', ' int jhyperthermia 201026485498', '84 torchilin vp', ' micellar nanocarriers pharmaceuticalperspectives', ' pharm res 200724116', '85 jones m leroux j', ' polymeric micelles  a new generation ofcolloidal drug carriers', ' eur j pharm biopharm 199948101111', '86 torchilin vp', ' structure and design of polymeric surfactantbased drug delivery systems', ' j control release 200173137172', '87 kwon gs', ' polymeric micelles for delivery of poorly watersoluble compounds', ' crit rev ther drug carrier syst200320357403', '88 yoo hs park tg', ' folate receptor targeted biodegradablepolymeric doxorubicin micelles', ' j control release200496273283', '89 cheng j teply ba sherifi i et al', ' formulation offunctionalized plgapeg nanoparticles for invivo targeteddrug delivery', ' biomaterials 200728869876', '90 esmaeili f ghahremani mh ostad sn et al', ' folatereceptortargeted delivery of docetaxel nanoparticles prepared byplgapeg folate conjugate', ' j drug target 200816415423', '91 matsumura y', ' polyamino acid micelle nanocarriers inpreclinical and clinical studies', ' adv drug deliv rev200860899914', '92 plummer r wilson rh calvert h et al', ' a phase i clinicalstudy of cisplatinincorporated polymeric micelles nc6004in patients with solid tumours', ' br j cancer 2011104593598', '93 matsumura y kataoka k', ' preclinical and clinical studies ofanticancer agentincorporating polymer micelles', ' cancer sci2009100572579', '94 kim ty kim dw chung jy et al', ' phase i andpharmacokinetic study of genexolpm a cremophorfreepolymeric micelleformulated paclitaxel in patients withadvanced malignancies', ' clin cancer res 20041037083716', '95 oerlemans c bult w bos m et al', ' polymeric micelles inanticancer therapy targeting imaging and triggered release', 'pharm res 20102725692589', '96 matsumura y', ' the drug discovery by nano medicine and itsclinical experience', ' jpn j clin oncol 201444515525', '97 kanasty rl whitehead ka vegas aj et al', ' action andreaction the biological response to sirna and its deliveryvehicles', ' mol ther 201220513524', '98 miteva m kirkbride kc kilchrist kv et al', ' tuning pegylationof mixed micelles to overcome intracellular and systemicsirna delivery barriers', ' biomaterials 20153897107', '99 lee jm yoon tj cho ys', ' recent developments innanoparticlebased sirna delivery for cancer therapy', 'biomed res int 20132013article id 782041', '', ''], 'Pharmaceutical Care In A Patient With Recurrent Infection After Liver Transplant': ['journal ofclinical and experimental pharmacologyissn 21611459zhu and sun clin exp pharmacol 2014 51doi 10', '417221611459', '1000166case reportopen accesspharmaceutical care in a patient with recurrent infection after livertransplantliqin zhu1 and xiaoye sun212department of pharmacy tianjin first central hospital tianjin chinadepartment of organ transplant tianjin first central hospital tianjin china', 'case description a case of a 57yearold liver transplant patient with biliary drainage catheter whose recurrentinfection was managed by clinical pharmacists', ' the suggestions about the choice of antibiotic regimen and themonitoring to other related infection factors such as biliary drainage catheter and concentration of tracrolimus wereaccepted and used to the patient', ' the state of the infected patient was improved', 'conclusion the antibiotics distribution antibacterial effect and drug resistance could be taken into considerationfor the patients with recurrent infection after liver transplant', ' the resistance of antibiotics could be deferred by alteringsuitable antibiotics', ' close care to catheter and immunosuppressants could be necessary to prevent infection for thepatients after transplant', 'keywords pharmaceutical care recurrent infection livertransplant', '', 'the recurrences of bacteria and virus infection are commonproblems in liver transplant recipients because of the biliary drainagecatheter and their extended state of immunosuppression', ' in recentyears gramnegative rods have emerged as the predominant pathogensin solid organ transplant sot recipients 13', ' among these gramnegative rods klebsiella pneumonia k', ' pneumoniae was the mostcommon bacteria identified in some case studies 3 and sot hasbeen implicated as a factor predisposing patients to k', ' pneumoniaebloodstream infection bsi 4', ' carbapenems which are regardedas effective agents for treating k', ' pneumonia infection induce theproduction and global spread of klebsiella pneumoniae carbapenemasekpc 5', ' although polymyxin b combined with tigecycline could beused for carbapenemresistant k', ' pneumoniae crkp 6 limitationsto the application of carbapenems are of great concern in k', ' pneumoniatherapy', 'this case report provided a series of therapeutic strategiesfrom view of the clinical pharmacist in a patient with recurrent k', 'pneumoniae infection after liver transplant', 'ethical approval no approval was necessarycase reportthe patient was a 57yearold man diagnosed with hepatitis bvirus hbvrelated cirrhosis and type ii diabetes', ' he underwent livertransplant surgery in december 2009', ' after his surgery ursodeoxycholicacid and losartan potassiumhydrochlorothiazide were administereddiscontinuously and biliary drainage catheter was kept in place becauseof elevated bilirubin levels and blood pressure', ' tacrolimus fk506 wasadministered at a decreasing dose and its concentration was within thetherapeutic window figure 1', ' he was examined by his physician atthe beginning of 2014 because of his recurrent infection in the thirdyear after surgery', ' the patient was tested for k', ' pneumoniae andenterococcus faecium 40 and 35 times respectively from december2012 to march 2014', ' most test results were normal', ' the patient sufferedinfections for three times one in december 2012 and two in january2013 induced by k', ' pneumoniae', ' his white blood cell wbc counttotal bile acid tbil alanine aminotransferase alt and aspartateaminotransferase ast varied during this period and there was noclin exp pharmacolissn 21611459 cpecr an open access journalnotable increase except for neutrophils neut figure 26', ' wbc andneut were fluctuated', ' neut were higher than normal for three times', 'although there were only three times abnormal blood chemistry datahe was still administered meropenem intravenously when abnormalbile occurred or when test results were positive for bacteria in his bile', 'his blood sugar was well controlled in this period', ' the patient consultedhis doctor whether this antibacterial dosage regimen was suitable', 'considering the details of the patient and the general conditionpharmacokinetics efficacy and drug resistance of antibiotics clinicalpharmacists provided the following suggestions', ' these suggestions wereaccepted by the doctor', ' by applying the series of therapeutic strategiesto the patient the state of the infected patient was improved', '1', ' ensuring that the biliary drainage catheter was still in need', 'if needed careful care of the catheter was required such asinspecting and flushing the catheter twice daily and emptyingcollected drainage from the bag daily', '2', ' carbapenems cephalosporins and broadspectrum penicillinantibiotics could be used in turn after confirming the infectionin the patient', '3', ' monitoring tacrolimus concentrations to avoid low immunitywhich could be result in infection', 'discussionin special population of liver transplants bacteria in bile were morefrequent', ' it was important that determining the relationship betweenbacteria in bile and infection', ' besides the antimicrobial spectrum ofantibiotics pharmacokinetic parameters especially the distributioncorresponding author liqin zhu pharm d chinical pharmacist pharmacydept', ' tianjin first center hospital tianjin china no', '24 fukang road nankaidistrict 300192 china tel 86 022 23626417 email zlq0713aliyun', 'comreceived november 04 2014 accepted november 28 2014 publisheddecember 01 2014citation zhu l sun x 2014 pharmaceutical care in a patient with recurrentinfection after liver transplant', ' clin exp pharmacol 4 166', ' doi10', '417221611459', '1000166copyright  2014 zhu l et al', ' this is an openaccess article distributed underthe terms of the creative commons attribution license which permits unrestricteduse distribution and reproduction in any medium provided the original author andsource are credited', 'concentration of fk506 ngmlclin exp pharmacolissn 21611459 cpecr an open access journalconcentrationulof antibiotics should be considered while choosing antibiotics for thepatients with recurrent infection', 'k', ' pneumoniae 7 and enterococcus faecium 8 were commonbacteria in the human intestinal tract', ' only under certain conditionscould infections be induced', ' for this patient the liver transplantsurgery and extended use of immunosuppressants after surgery whichclin exp pharmacolissn 21611459 cpecr an open access journalmaintained reduced immunity made infection easier', ' moreover thebiliary drainage catheter and diabetes also increase the incidence ofinfection', 'while infection occurred after liver transplant antibiotic use shouldbe considered for this patient', ' carbapenems such as meropenem wereusually used in patients after liver transplant because of their higherpage 4 of 4hepatobiliarysystemdistributionantiinfectioneffectnote    the distribution and drug resistance varied from low  to high the antiinfection effect varied from weak  to strong   no distributiontable 1 comparison between different kinds of antibiotics', 'antibacterial effectiveness', ' the patient was prescribed meropenemas soon as the bacteria were detected', ' however the bacterial testresults did not accurately represent the infection', ' the physicianhad to ensure that the antibiotic use was needed to the patient', 'moreover clinical pharmacist suggested that the pharmacokineticspharmacodynamics and drug resistance conditions should be takeninto consideration', ' detailed information was presented in table 1', 'of all the antiklebsiella pneumoniae drugs only fluoroquinolonesfqns have poor distribution in the hepatobiliary system', ' thereforefqns should not be applied in this patient', ' although the effectivenessof carbapenems against infection was higher than cephalosporinsand broadspectrum penicillins their lower distribution in thehepatobiliary system and higher drug resistance somehow limited theirusing', ' clinical pharmacists suggested alternating use among the threekinds of antibiotics to avoid resistance', ' for some antibiotics that weremetabolized by liver such as cefoperazone the side effects especiallyliverrelated side effects and drugdrug interactions should be carefullymonitored by clinical pharmacists', 'additional information should be considered to preventinflammation as follows 1 cleaning the biliary drainage catheter', 'the biliary drainage catheter should be flushed twice daily usingnormal saline and the bag should also be emptied daily', ' the dressingstopcock and the drainage bag should be changed once a week', ' thedressing should be changed more frequently if it became loose wetor soiled and 2 monitoring immunosuppressant', ' an infection afterliver transplant is often related to lower immunity', ' immunosuppressantmonitoring was required for the rest of his life after the transplant', 'clin exp pharmacolissn 21611459 cpecr an open access journalthe therapeutic strategy for patients with recurrent k', ' pneumoniainfection after liver transplant should be carefully considered', ' the cathetershould be sterilized according to the protocol immunosuppressantshould be controlled and managed and appropriate antibiotics shouldbe chosen', ' antik', ' pneumonia antibiotics should be rotated betweencarbapenems cephalosporins and broadspectrum penicillins bytaking the antiinfection effect drug distribution and drug resistanceinto consideration', 'acknowledgmentthis work was supported by national high technology developmentproject 2012aa021003 and the key projects of tianjin health bureau12kg103', '', '', '', '', '1', ' linares l garciagoez jf cervera c almela m sanclemente g et al', ' 2009early bacteremia after solid organ transplantation', ' transplant proc 41 22622264', '2', ' alhasan mn razonable rr eckelpassow je baddour lm 2009incidence rate and outcome of gramnegative bloodstream infection in solidorgan transplant recipients', ' am j transplant 9 835843', '3', ' singh n wagener mm obman a cacciarelli tv de vera me et al', ' 2004bacteremias in liver transplant recipients shift toward gramnegative bacteriaas predominant pathogens', ' liver transpl 10 844849', '4', ' meatherall bl gregson d ross t pitout jd laupland 2009 kb incidencerisk factors and outcomes of klebsiella pneumoniae bacteremia', ' am j med122 866873', '5', ' bergamasco md barroso barbosa m de oliveira garcia d cipullo r moreirajc et al', ' 2012 infection with klebsiella pneumoniae carbapenemase kpcproducing k', ' pneumoniae in solid organ transplantation', ' transpl infect dis 14198205', '6', ' lee j patel g huprikar s calfee dp jenkins sg 2009 decreasedsusceptibility to polymyxin b during treatment for carbapenemresistantklebsiella pneumoniae infection', ' j clin microbiol 4716111612', '7', ' wong mt choi sb kuan cs chua sl chang ch normi ym et al', ' 2012structural modeling and biochemical characterization of recombinantkpn02809 a zincdependent metalloprotease from klebsiella pneumoniaemgh 78578', ' int j mol sci 13 901917', '8', ' castillorojas g mazarihiríart m ponce de león s amievafernándezri agisjuárez ra et al', ' 2013 comparison of enterococcus faecium andenterococcus faecalis strains isolated from water and clinical samplesantimicrobial susceptibility and genetic relationships', ' plos one 8e59491', '', ''], 'Pharmacological Options Beyond Proton Pump Inhibitors In Childrenwith Gastroesophageal Reflux Diseas': ['journal of developing drugsissn 23296631armano et al', ' j dev drugs 2016 53doi 10', '417223296631', '1000161open accessreview articlepharmacological options beyond proton pump inhibitors in childrenwith gastroesophageal reflux diseasearmano c fumagalli la ripepi a moretti a macchi f scolari a and salvatore spediatric department ospedale f', ' del ponte università dellinsubria varese italycorrespondingauthor salvatore s pediatric department ospedale f', ' del ponte università dellinsubria varese italy tel 00390332 299247 emailsilvia', 'salvatoreuninsubria', 'itreceived date august 29 2016 accepted date october 10 2016 published date october 18 2016copyright  2016 armano c et al', ' this is an openaccess article distributed under the terms of the creative commons attribution license which permits unrestricteduse distribution and reproduction in any medium provided the original author and source are credited', '', 'pharmacological treatment of gastroesophageal reflux ger disease is mostly based on acid control', ' howeverdifferent molecules have been proposed both for patients with persisting symptoms and to limit adverse effects ofproton pump inhibitors ppi', ' this paper focuses on other acid inhibitors alginate prokinetics drug acting on loweresophageal sphincter and esophageal hypersensitivity', ' mechanism of action indications efficacy limits and recentadvances are reported', ' pediatric data and possible adverse effects are also considered', 'keywords reflux ranitidine alginate prokinetics baclofenabbreviationsasic acidsensitive ion channels espghan european society forpaediatric gastroenterology hepatology and nutrition gaba γaminobutyric acid ger gastroesophageal reflux gerdgastroesophageal reflux disease naspghan north americansociety for pediatric gastroenterology hepatology and nutritionnice national institute for health and care excellence ppi protonpump inhibitors pcabs acidinhibitor acting on potassium ssrisserotonine selective reuptake inhibitors tlesrs transient loweresophageal sphincter relaxation trpv transient receptor potentialvanilloid', '', '', 'proton pump inhibitors ppi are the treatment of choice both forchildren and adolescents with heartburn reflux esophagitispathological acid exposure or significant association with symptomsrelated to acid gastroesophageal reflux ger detected by impedancephmonitoring 1', ' persisting symptoms on ppi may be related toseveral factors such as insufficient drug dosage e', 'g', ' in neurologicalpatients incorrect intake e', 'g', ' not before the first meal of the daymajor effect of the nonacid component or currently classified asweakly acid reflux with ph4 or of the volume of reflux esophagealdistention in the generation of symptoms esophageal hypersensitivityprimary motor disorders or other diagnosis non ger disorder', 'the pathogenesis of ger disease gerd is complex and includeseveral contributing factors such as inappropriate lower esophagealsphincter les relaxations abnormal esophageal motility andclearance delayed gastric emptying increased both acid and nonacidger impaired esophageal resistance and esophageal hypersensitivity', 'physiologic ger and infantile regurgitation do not need medicaltreatment although they frequently cause parental distress andanxiousness 1', ' management in these patients should be based onparental education and reassurance dietary and eventually positionaltreatment', 'j dev drugs an open access journalissn 23296631pharmacological therapy used to treat gerd encompassantisecretory agents antacids surface barrier agents prokineticsagents reducing les relaxations and more recently in adult patientsantidepressant drugs', ' from the pathophysiologic point of viewprokinetic drugs are the most logic therapeutic approach to treatgerd because they improve the motility of both esophagus andstomach reducing the time of the esophageal contact with refluxateand accelerating gastric emptying', ' however there is no effective andsafe prokinetic agent on the market', 'appropriate treatment of gerd is important to reduce ger relatedsymptoms and possible esophageal e', 'g', ' esophagitis and extraesophageal e', 'g', ' respiratory manifestations sleeping or feedingdisturbances complications and to improve quality of life of thepatients', 'this article focuses on current therapeutic pharmacological optionsbeyond ppi in gerd and updates the current pediatric data of otheracidinhibitors barrier agents prokinetics and drugs that act on theinferior esophageal sphincter or on the symptomatic sensitivitytable 1', ' neither nonpharmacological therapies e', 'g', ' posturaldietetic ones nor endoscopic and surgical treatments will be hereindiscussed', 'other acidinhibitors except ppiranitidine is often too much administered especially in infantson clinical basis without a proven diagnosis of gerd', ' the preferencetowards ranitidine compared to ppi is mostly related to its availabilityas a syrup and offlabel use of ppi in the first year of life', ' ranitidine atan oral dose of 510 mgkgdie divided in 23 doses suppresses thegastric acid secretion less partially and for a shorter period about48 hours of time compared to ppi and is often associated withtachyphylaxis which cannot be solved with an increase of the dosage', 'in 2006 pfefferkorn evaluated the possible benefit of ranitidine 4mgkg as addon therapy to ppi to cover the nighttime acidsecretion nocturnal acid breakthrough in children with refluxesophagitis', ' there was no evidence of any decrease in the symptomaticscore in the acid exposure detected by phmonitoring or in theesophageal mucosal lesions compared to placebo 2', 'table 1 pharmacological therapy of gerd beyond acidinhibitorsmolecules and mechanismsa systematic review analysing 8 studies 276 children treated haverecently reported a limited evidence of effectiveness and safety inpediatric age and a lack of good quality data', ' conversely adverseeffects similar to ppi have been shown including increased infectionsvariation of the intestinal microbiota and an increased risk ofnecrotizing enterocolitis in premature babies 3', 'cimetidine has seldom been used as acidinhibitor in children andis not recommended for its side effects on cytochrome p450 on themetabolism of vitamin d and on the endocrine function', 'other drugs have been proposed for adult patients with gerd e', 'g', 'vonoprazan a new acidinhibitor acting on potassium pcabswhich seems to have a stronger and more lasting effect of acidsuppression compared to ppi 45', 'current available information about antacids based on potassiumsodium bicarbonate aluminum and magnesium hydroxide or calciumsalts in children with gerd are too limited to recommend their useand concern about the prolonged use of aluminum has been raisedespecially in young children and in patients affected by kidney diseases1', 'j dev drugs an open access journalissn 23296631alginatealginate is a polysaccharide derived from brown seaweed and it canabsorb water or react with gastric enzymes like pepsin thus increasingthe viscosity of the gastric content', 'alginate based drugs can act on gerd both physically through amechanic effect in the stomach and chemically reducing acid content', 'alginate precipitates in an acidic environment and quickly creates afew minutes after administration a viscous gel or rafting in the upperpart of the stomach thus reducing reflux', ' besides some commercialalginate compounds may decrease acid ger because of theconcomitant presenceof antacids e', 'g', ' bicarbonate with a foam effectover gel and gastric content thus reducing the backwash of the acidpocket located in the gastric fundus', ' however alginate is not currentlyrecommended for the treatment of esophagitis for less evidence ofefficacy compared to ranitidine and ppi but only for heartburn inolder children and for regurgitations associated to other distressingsymptoms in infants 67', 'in 2000 a review evaluated the effect of alginate based specificformulations gaviscon and gaviscon infant and included 6 pediatricstudies for a total amount of 303 treated children or infants', ' only onedoubleblind trial was available', ' the authors reported a significanteffect of alginate in reducing regurgitationvomiting and heartburn apossible benefit on the phmonitoring parameters in one study with aconcurrent presence of thickening agents and less effectivenesscompared to h2antagonists in the treatment of esophagitis', ' tolerancewas satisfactory in all patients and the only report assessing side effectsshowed diarrhea or constipation in few patients with a similar ratecompared to placebo 8', ' a doubleblind pediatric trial which enrolled20 infants with random administration 33 of milk formula onoffan alginate formulation gaviscon infant without antacids showed adecrease of all reflux parameters assessed by impedancephmonitoring with a significant effect of alginate only for the heightesophageal extension of reflux 9', 'in 32 preterm newborns corvaglia et al', ' confirmed a significantreduction of proximal gasseous and acid reflux and of the acidesophageal exposure after the 4 meals with alginate gaviscon 0', '25mlkgdose compared with the other 4 drugfree meals 10', ' anothertrial of the same year which have analysed only one postprandialperiod with alginate reported the decrease of acid ger without aconcurrent effect on the reflux related apneas in 28 preterm newborns', 'no adverse effect occurred 11', ' in 2015 a clinical study comparing 3groups of infants showed a greater reduction of ger related symptomsin the group 25 infants treated for 2 months with a magnesium plussimeticone alginate based formulation gastrotuss baby 2', '5 to 5 mlsthree times per day compared to the other two groups one treatedwith a thickened milk formula and the other one with parentalreassurance', ' only one infant reported constipation as a possible sideeffect of the treatment 12', 'currently the evidence of effectiveness of alginate in ger is limitedin the pediatric age whereas its more validated in the adults', 'considering the lack of information naspghan and espghanguidelines published in 2009 did not recommend alginate in gerdtreatment 1', ' more recently nice guidelines have considered alginateas first pharmacological approach in ger with a 12 weeks trial toextend in case of benefit in infants with severe reflux symptomsregurgitations and marked distress persisting after parentalreassurance postural treatment and diet changes 7', ' its recommendedto use formulations without aluminum and to consider the sodiumarmano c fumagalli la ripepi a moretti a macchi f et al', ' 2016 pharmacological options beyond proton pump inhibitors inchildren with gastroesophageal reflux disease', ' j dev drugs 5 161', ' doi10', '417223296631', '1000161page 3 of 5content variable according to the different commercial products for aprolonged use particularly in preterm newborns and in children withkidney diseases', 'the heterogeneity of age of the populations of commercial alginateformulations and outcomes does not allow a proper metaanalysis ofthe results', 'in a trial recruiting 16 adults affected by gerd an alginateantacidbased product gaviscon double action liquid proved to be locatedinto the postprandial acid pocket an upper stomach area notbuffered by meal right under the diaphragm and close to les thusreducing the postprandial acid reflux 13', 'prokineticsfrom a pathogenetic point of view prokinetics should be one of themost rational therapeutic approach in patients with gerd especiallyin case of nonacid reflux disease', ' nevertheless prokinetics are notrecommended as gerd treatment in infants and children because ofthe limited evidence of efficacy and their known neurological andcardiological adverse events', 'no recent trials using erythromycin a macrolide that promotesperistalsis and gastric emptying binding to motilin receptors ormetoclopramide a molecule with an alfa sympathomimetic effect withdopamine and serotonin receptor antagonism as gerd treatment inchildren are available', ' moreover metoclopramide should not beadministered because of its high rate of serious side effects likelethargy irritability gynaecomastia galactorrhoea and extrapyramidalreactions with possible permanent dyskinesia', 'domperidone is a dopamine receptor antagonist d2 with a gastricprokinetic effect', ' a systematic review on domperidone published in2005 identified only 4 controlled randomized trials in children and noone of them showed a significant evidence of efficacy supporting its usein pediatric gerd 14', ' in 2008 cresi et al', ' assessed the effect ofdomperidone in 13 neonates with symptoms of gerd usingimpedanceph monitoring', ' the number of reflux episodes increasedalthough the duration of each ger events decreased 15', 'furthermore domperidone may cause extrapyramidal effects increaseof prolactin unpredictable increase of qtc on ecg and seriousventricular arrhythmias with possible sudden death 16', 'myenteric plexus of cellular bodies and of nerve fibers of the nodoseganglion except gabaa ones in the dorsal motor and in thesolitary tract nuclei 18', ' pharmacological molecules which interactwith these receptors may thus determine a reduction of ger through aperipheral action but may concurrently also cause central side effects', 'gammaaminobutyric acid type b receptor agonist baclofen is oftenused to reduce spasticity in neurological patients', ' moreover in adultpatients with ger baclofen reduced tlesrs of 4060 both acid andnonacid postprandial ger and a symptomatic score increased lesbasal pressure and accelerated gastric emptying 19', ' because of itspassage through the bloodbrain barrier several side effects have beenreported in patients treated with baclofen such as headache fatiguetiredness drowsiness lethargy confusion unsteadiness dizzinesshypotension memory lapses dyspnoea sensation weakness tremorand reduction of seizure threshold', 'a 1week small trial in 8 neurologically impaired children withgerd treated with baclofen showed a reduction in the number of acidreflux episodes and in the frequency of emesis in 6 children whilstthe percentage of esophageal acid exposure reflux index didntdecrease and the esophageal clearance time increased in 4 out of 8patients 20', ' the efficacy of 0', '5 mgkg baclofen has been evaluated inthe only randomised placebo controlled trial in 30 children affected byresistant gerd', ' measurement of esophageal motility and ph duringthe 2 hours test period showed a significant reduction of the incidenceof tlesr and a significant acceleration of gastric emptying 21', ' noimportant adverse effect occurred during the first 48 hours posttreatment', ' more recently a retrospective analysis including 53 childrenwith proven gerd or gerd related symptoms such as heartburnregurgitation vomiting abdominal pain weight loss dyspepsia lack ofappetite coughing dental erosion treated with 0', '5 mgkgday or 30mgdie maximum of baclofen in 3 divided doses showed a significantreduction in symptoms in 23 35 of patients at their first followupevaluation and in 22 patients after 12 months respectively', ' in 3patients the treatment was stopped because of sleepiness 22', 'prospective studies are needed to validate these preliminary resultsand assess baclefon safety', 'arbaclofen placarbil has only been studied in adults withoutsignificant efficacy compared to placebo in reducing symptoms ofgerd 2324', 'no pediatric studies have been published so far and limited data areavailable in adult patients treated for gerd with other prokineticmolecules like mosapride itopride prucalopride levosulpiriderevexepride and renzapride or motilin agonists 17', 'in another trial in adult patients lesogaberan another gababreceptor agonist with a peripheral action showed an importantreduction of both tlesr and of acid and postprandial nonacid reflux25', 'bethanechol a choline carbamate with para sympathomimeticaction selectively stimulating muscarinic receptors as a cholinergicagonist showed a doubtful effectiveness and a high rate of side effectsin children affected by gerd 1', 'preliminary analysis in adults with gerd treated with mglur5selective receptor antagonists azd2066 adx10059 reported areduction tlesrs and of acid reflux with adverse events like instabilityin 3 out of 13 and attention disorders in 3 out of 13 or an increaseof liver enzymes 18', 'drugs acting on lesinappropriate because not triggered by swallowing transient lesrelaxations tlesrs are one of the most important mechanism inreflux genesis at any age and are mediated by a vasovagal reflexstimulated by gastric distention', ' this reflex can be blocked by aninteraction with 5 metabotropic glutamate receptors mglur5 a andb alfaaminobutyric acid receptors gaba a b and cannabinoidones cb 12', ' the above receptors recently proved to be widelyexpressed except gabaa receptors in the neurons of lesj dev drugs an open access journalissn 23296631esophageal hypersensitivity therapy and future perspectivein the last ten years it has been clearly demonstrated that manypatients suffering from gerd present nonerosive reflux disease thatboth esophageal symptoms and mucosal injuries can occur withnonacid ger ph4 and that several sensory receptors are locatedin the esophagus and respond to different ph transient receptorpotential vanilloid receptor trpv type 1 and tprv4 at ph6 acidsensitive ion channels asic between ph 6 and 7 and p2x at ph7', 'armano c fumagalli la ripepi a moretti a macchi f et al', ' 2016 pharmacological options beyond proton pump inhibitors inchildren with gastroesophageal reflux disease', ' j dev drugs 5 161', ' doi10', '417223296631', '1000161page 4 of 5however the manifestation of pain heartburn or other symptoms aredependent on many components chemical physical and mechanicalones related to ph to volume and content of ger or to esophagealdistention clearance and mucosal defense and particularly on theindividual threshold of perception of one or more stimuli', 'neither enough information nor current studies on mucosalprotective drugs such as sucralfate are available in pediatric patientsand they are not recommended by the current guidelines on gerdtreatment 1', ' sucralfate is a sucrose sulphate and aluminiumcompound that in an acid environment creates a gel binding to themucosa with peptic erosions', ' the only pediatric randomizedcontrolled study available was published in 1989 and proved thatsucralfate was as effective as cimetidine in the treatment of esophagitisserotonine selective reuptake inhibitors ssris have beenproposed in adult patients with esophageal hypersensitivity negativeendoscopy and acid exposure at phmonitoring but positive symptomassociation with ger in the impedancephmonitoring 27', 'analgesic drugs and low doses of tricyclic antidepressants have beensuggested in case of functional heartburn symptoms of ger butnormal endoscopy and impedancephmonitoring 27', 'pain modulators like tricyclic antidepressants trazodoneserotoninenorepinephrine reuptake inhibitors or ssris can act as gutanalgesics both through central nervous system effects andor sensorynerve fibers afferents', 'a systematic review has recently analysed the efficacy ofantidepressants in adults with gerd or esophageal functionaldisorders with symptoms like heartburn or chest pain dysphagia orpharyngeal globus caused by possible esophageal visceral hyperalgesia', 'overall 378 articles and 15 randomised controlled trials eligible for theinclusion criteria were identified', ' after antidepressant therapy theesophageal pain threshold raised from 7 to 37 with a reduction ofpain from 18 to 67 and a reduction of heartburn in patients withgerd from 23 to 61 highlighting that antidepressants can easeesophageal symptoms in a subgroup of patients with gerd 28', 'further controlled trials are needed to evaluate their effects onesophageal functional disorders 28', 'no study evaluates the prevalence of esophageal functionaldisorders in children and analgesics or antidepressants effect inpediatric patients with gerd', '', '', 'as reported by a recent cochrane review on pharmacologicaltreatment of children with gerd analyzing 24 randomized controlledtrials for an amount of 1201 children there is no enough evidence ofthe efficacy of prokinetics there is some evidence of benefit using h2antagonists and theres a moderate evidence of a specific alginateformulation in improving infants symptoms 6', ' data about gabareceptor agonists are still too limited and there are no pediatric data onpain modulators or mucosal protective agents in patients with gerd', 'several adverse effects have been shown for all categories of drugs', ' aproper diagnostic workup and an adequate assessment of the safetyprofile of the molecule are fundamental before starting anypharmacological treatment in infants and children with onlysymptoms or evidence of gerd', 'j dev drugs an open access journalissn 23296631', '', 'vandenplas y rudolph cd di lorenzo c hassall e liptak g et al', '2009 pediatric gastroesophageal reflux clinical practice guidelinesjoint recommendations of the north american society of pediatricgastroenterology hepatology and nutrition naspghan and theeuropean society of pediatric gastroenterology hepatology andnutrition espghan', ' j pediatr gastroenterol nutr 49 498547', 'pfeffrkorn md croffie jm gupta sk molleston jp eckert gj et al', '2006 nocturnal acid breakthrough in children with reflux esophagitistaking proton pump inhibitors', ' j pediatr gastroenterol nutr 42 160165', 'van der pol r langendam m benninga m van wijk m tabbers m2014 efficacy and safety of histamine2 receptor antagonists', ' jamapediatr 168 947954', 'hunt rh scarpignato c 2015 potassiumcompetitive acid blockerspcabs are they finally ready for prime time in acidrelateddisease clin transl gastroenterol 6 e119', 'otake k sakurai y nishida h fukui h tagawa y et al', ' 2016characteristics of the novel potassiumcompetitive acid blockervonoprazan fumarate tak438', ' adv ther 33 11401157', 'tighe m afzal na bevan a hayen a munro a et al', ' 2014pharmacological treatment of children with gastrooesophageal reflux', 'cochrane database syst rev cd008550', 'national institute for health and care excellence nice 2015 clinicalknowledge summaries on gastroesophageal reflux disease in children', 'ng1', 'mandel kg daggy bp brodie da jacoby hi 2000 review articlealginateraft formulations in the treatment of heartburn and acid reflux', 'aliment pharmacol ther 14 669690', 'del buono r wenzl tg ball g keady s thomson m 2005 effect ofgaviscon infant on gastrooesophageal reflux in infants assessed bycombined intraluminal impedanceph', ' arch dis child 90 460463', 'corvaglia l aceti a mariani e de giorgi m capretti mg et al', ' 2011the efficacy of sodium alginate gaviscon for the treatment of gastrooesophageal reflux in preterm infants', ' alimenti pharmacol ther 33466470', 'corvaglia l spizzichino m zama d aceti a mariani e et al', ' 2011sodium alginate gaviscon does not reduce apnoeas related to gastrooesophageal reflux in preterm infants', ' early hum dev 87 775778', 'ummarino d miele e martinelli m scarpato e crocetto f et al', ' 2015effect of magnesium alginate plus simethicone on gastroesophageal refluxin infants', ' j pediatr gastroenterol nutr 60 230235', 'rohof wo bennink rj smout aj thomas e boeckxstaens ge 2013an alginateantacid formulation localizes to the acid pocket to reduceacid reflux in patients with gastroesophageal reflux disease', ' clingastroenterol hepatol 11 15851591', 'pritchard ds baber n stephenson t 2005 should domperidone beused for the treatment of gastrooesophageal reflux in childrensystematic review of randomized controlled trials in children aged 1month to 11 years old', ' br j clin pharmacol 59 725729', 'cresi f marinaccio c russo mc miniero r silvestro l 2008 shortterm effect of domperidone on gastroesophageal reflux in newbornsassessed by combined intraluminal impedance and ph monitoring', ' jperinatol 28 766770', 'michaud v turgeon j 2013 domperidone and sudden cardiac deathhow much longer should we wait j cardiovasc pharmacol 61 215217', 'vandenplas y 2014 management of paediatric gerd', ' nat revgastroenterol hepatol 11 147157', 'rohof wo aronica e beaumont h troost d boeckxstaens ge 2012localization of mglur5 gabab gabaa and cannabinoid receptors onthe vagovagal reflex pathway responsible for transient lower esophagealsphincter relaxation in humans an immunohistochemical study', 'neurogastroenterol motil 24 383e173', 'vela mf tutuian r katz po castell do 2003 baclofen decreases acidand nonacid postprandial gastrooesophageal reflux measured byarmano c fumagalli la ripepi a moretti a macchi f et al', ' 2016 pharmacological options beyond proton pump inhibitors inchildren with gastroesophageal reflux disease', ' j dev drugs 5 161', ' doi10', '417223296631', '1000161combined multichannel intraluminal impedance and ph', ' alimentpharmacol ther 17 243251', 'kawai m kawahara h hirayama s yoshimura n ida s 2004 effect ofbaclofen on emesis and 24hour esophageal ph in neurologicallyimpaired children with gastroesofageal reflux disease', ' j pediatrgastroenterol nutr 38 317323', 'omari ti benninga ma sansom l butler rn dent j et al', ' 2006 effectof baclofen on esophagogastric motility and gastroesophageal reflux inchildren with gastroesophageal reflux disease a randomized controlledtrial', ' j pediatr 149 468474', 'vadlamudi nb hitch mc dimmitt ra thame ka 2013 baclofen forthe treatment of pediatric gerd', ' j pediatr gastroenterol nutr 57808812', 'vakil nb huff fj bian a jones ds stamler d 2011 arbaclofenplacarbil in gerd a randomized doubleblind placebocontrolledstudy', ' am j gastroenterol 106 14271438', 'vakil nb huff fj cundy kc 2013 randomized clinical trial arbaclofenplacarbil in gastrooesophageal reflux diseaseinsights into study designj dev drugs an open access journalissn 23296631for transient lower sphincter relaxation inhibitors', ' aliment pharmacolther 38 107117', 'miner pb jr silberg dg ruth m miller f pandolfino j 2014 dosedependent effects of lesogaberan on reflux measures in patients withrefractory gastroesophageal reflux disease a randomized placebocontrolled study', ' bmc gastroenterol 14 188', 'arguellesmartin f gonzalezfernandez f gentles mg 1989 sucralfateversus cimetidine in the treatment of reflux esophagitis in children', ' am jmed 86 7376', 'zerbib f sifrim d tutuian r attwood s lundell l 2013 modernmedical and surgical management of difficulttotreat gord', ' unitedeuropean gastroenterol j 1 2131', 'weijenborg pw de schepper hs smout aj bredenoord aj 2015 effectsof antidepressants in patients with functional disorders orgastroesophageal reflux disease a systematic review', ' clin gastroenterolhepatol 13 251259', ''], 'Phospolipids And Application': ['h o s t e d bysciencedirectjournal homepage httpees', 'elsevier', 'comajpsdefault', 'aspreviewa review on phospholipids and their mainapplications in drug delivery systemsjing li xuling wang ting zhang chunling wang zhenjun huangxiang luo yihui dengschool of pharmacy shenyang pharmaceutical university no', ' 103 wenhua road shenyang 110016 chinaarticle info', 'article historyphospholipids have the characteristics of excellent biocompatibility and a especialreceived 27 june 2014amphiphilicity', ' these unique properties make phospholipids most appropriate to bereceived in revised formemployed as important pharmaceutical excipients and they have a very wide range of29 august 2014applications in drug delivery systems', ' the aim of this review is to summarize phosphoaccepted 10 september 2014lipids and some of their related applications in drug delivery systems and highlight theavailable online 28 september 2014relationship between the properties and applications and the effect of the species ofphospholipids on the efficiency of drug delivery', ' we refer to some relevant literatureskeywordsstarting from the structures main sources and properties of phospholipids to introducephospholipidstheir applications in drug delivery systems', ' the present article focuses on introducing fivebiocompatibilitytypes of carriers based on phospholipids including liposomes intravenous lipid emulamphiphilicitysions micelles drugphospholipids complexes and cochleates', 'drug delivery systems 2015 shenyang pharmaceutical university', ' production and hosting by elsevier b', 'v', ' allrights reserved', '1', '', '', 'therapeutic agents such as proteinspeptides nucleic acidsanticarcinogens and other drugs have the drawbacks of lowbioavailability rapid clearance and high toxicity', ' thereforethere is a great demand to develop delivery methods andcarriers which will bring a more efficient delivery fortherapeutics', 'drug delivery systems dds are capable of designing toincrease the bioavailability of drugs control drug delivery andmaintain the drug intact transport to the site of action whileavoiding the nondiseased host tissues', ' briefly in a suitabledosage and mode of administration using the smallest doseto achieve the best therapeutic effect is the research objectiveof dds', 'as main components of cellular membrane phospholipidshave excellent biocompatibility', ' in addition phospholipidsare renowned for their amphiphilic structures', ' the amphiphilicity confers phospholipids with selfassembly emulsifying and wetting characteristics', ' when introduced intoaqueous milieu phospholipids selfassembly generatesdifferent supermolecular structures which are dependent ontheir specific properties and conditions', ' for example corresponding author', ' shenyang pharmaceutical university no', ' 103 wenhua road shenyang 110016 china', ' tel', 'fax þ86 24 23986316', 'email address pharmdenggmail', 'com y', ' deng', 'peer review under responsibility of shenyang pharmaceutical university', 'httpdx', 'doi', 'org10', '1016j', 'ajps', '2014', '09', '00418180876 2015 shenyang pharmaceutical university', ' production and hosting by elsevier b', 'v', ' all rights reserved', 'phospholipids have a propensity to form liposomes whichcan be employed as the drug carriers 1', ' phospholipids havegood emulsifying property which can stabilize the emulsions2', ' in addition phospholipids as surfaceactive wettingagents which can coat on the surface of crystals to enhancethe hydrophility of hydrophobic drugs 3', ' the above properties are successfully employed in the dds design', 'phospholipids based dds have been found promising forbetter and effective delivery of drugs and providing muchappropriate systematic drug delivery', ' in recent years a varietyof phospholipidrelated formulations such as doxil 4cleviprex 5 valium 6 and silybin phytosome 7 havebeen used in clinic and achieving good results', 'phospholipids are molecules in which hydrophilic headgroup and hydrophobic acyl chains are linked to the alcohol', 'the variation in head groups aliphatic chains and alcoholsleads to the existence of a wide variety of phospholipids', ' inaddition the different sources of phospholipids also enhancethe species of phospholipids', ' various phospholipids such assoybean phosphatidylcholine egg phosphatidylcholine orsynthetic phosphatidylcholine as well as hydrogenatedphosphatidylcholine are commonly used in different types offormulations', ' phospholipids become intriguing as they canoffer various options', ' however the species diversity of phospholipids make how to select an appropriate phospholipid toachieve the therapeutic purpose become a crucial problem inthe design of dds so we summarized the structures mainsources properties of phospholipids which can give a guideline in the design of dds', ' in addition we set liposomesintravenous lipid emulsions pcbile salt mixed micellesphospholipid micelles drugphospholipid complexes cochleates as examples to introduce the main applications associated with phospholipids and further explain how to make achoice among the phospholipids in drug delivery', 'phospholipidsphospholipids are lipids containing phosphorus a polarpotion and nonpolar potion in their structures', 'sphingomyelinsin 1884 thudicum first described sphingomyelins sms but itwas not until 1927 that pick and bielschowsky proved theirstructures to be nacylsphingosine1phosphatidylcholineaccording to the alcohols contained in the phospholipidsthey can be divided into glycerophospholipids andsphingomyelins', '2', '1', '1', 'phosphatidylglycerol pg cardiolipin cl table 1', ' the lengthof the apolar moieties leads to different glycerophospholipidse', 'g', ' dipalmitoyl dimyristoyl distearoyl pc', ' the saturation ofaliphatic groups characterizes different glycerophospholipidssuch as dioleoyl distearoyl pc', ' the type of bonding ester orether between aliphatic chains and glycerol determinesdifferent glycerophospholipids such as plasmalogen 9', ' thenumber of aliphatic chains is different for example lysophospholipids have only one acyl group at the glycerol backbone 10 fig', ' 1', 'glycerophospholipidsglycerophospholipids which are the main phospholipids ineukaryotic cells refer to the phospholipids in which glycerol isthe backbone', ' all naturally occurring glycerophospholipidspossess astructure and lconfiguration 8', 'the chemical structures of glycerophospholipids can beclassified by the head group the length and the saturation ofhydrophobic side chains the type of bonding between thealiphatic moieties and glycerol backbone and the number ofaliphatic chains', ' variation in the head group leads todifferent glycerophospholipids such as phosphatidylcholinepc phosphatidylethanolamine pe phosphatidylserine psphosphatidicacidpaphosphatidylinositolfig', ' 1 e schematic representation of the structures of phospholipids', 'fig', ' 1', ' in 1962 shapiro and flowers confirmed that all sms ofbiological sources are derythro configuration 12', 'sms are an important component of animal cell membranes', ' although pc and sm are very similar in molecularstructure they still have some differences', ' 1 the backbone ofsm is a sphingosine while the backbone of pc is a glycerol', ' 2each sm molecule averagely contains 0', '1e0', '35 cisdoublebonds in amidelinked acyl chains and pc contains 1', '1e1', '5cisdouble bonds', ' it is obvious that the saturation of hydrophobic regions of sms is higher than that of pcs', ' 3 the typicalacyl lengths of the naturally occurring sms are usually morethan 20 while the paraffin residues of sphingosine are relatively shorter so the sms are asymmetric molecules 13 incontrast pcs typically contain moderate lengths 16e18 ofthe acyl chains and the lengths of two chains are approximately equal so the pcs are symmetric molecules 14', ' 4 smsare capable of forming intermolecular and intramolecularhydrogen bonds so the sm and pc bilayer have a significantdifference in the macroscopic properties 13', ' 5 the range ofphase transition temperature tc of all naturally occurringsms is 30e45  c which is above the natural pcs 13', ' 6numerous observations have shown that sm and cholesterolhave a very strong interaction for example compared withthe nonsaturated pccholesterol bilayer smcholesterolbilayer has higher compressibility and lower permeability towater', ' the reason for this phenomenon is that higher saturation of the acyl chain of sm leads to stronger interactionwith steroid nucleus 13', '2', '2', 'the main sources of phospholipidsaccording to the sources phospholipids can be divided intonatural phospholipids and synthetic phospholipids', '2', '2', '1', 'natural phospholipidsin 1793 fourcroy was likely to be the first to find the existenceevidence of complex aliphatic compounds', ' in 1812 uauquelinfound phospholipids in human brain', ' in 1846 gobley separated phospholipids from egg yolk', ' the term lecithin whichis derived from the greek lekithos was first used to describe asticky orange material isolated from egg yolk', ' after 20 yearscholine component in lecithin was determined 15', ' currently84a s i a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 1 0  2 0 1 5  8 1 e9 8there are three definitions of lecithin appeared in literaturesincluding 1 from a business perspective lecithin mainlyincludes pc pe ps pi other phospholipids triglycerides fattyacids and carbohydrates 2 from a historical point of viewlecithin refers to the lipids containing phosphorus isolatedfrom eggs and brains 3 from a scientific point of view lecithin refers to pcs 16', 'phospholipids are widely distributed in animals and plantsand the main sources include vegetable oils e', 'g', ' soybean cotton seed corn sunflower and rapeseed and animal tissues e', 'g', 'egg yolk and bovine brain', ' in terms of production egg yolk andsoybean are the most important sources for phospholipids 17', 'however soybean and egg yolk have differences in the contentsand species of phospholipids mainly including 1 egg yolklecithin contains a higher amounts of pc 2 phospholipids inegg yolk exist long chain polyunsaturated fatty acids of n6 andn3 series primarily arachidonic acid aa and docosahexaenoic acid dha which are absent in soybean lecithins 3 animal lecithins have characteristic of the presence of sm 18 4the saturation level of egg yolk lecithins is higher than that ofsoybean lecithins 19 so their oxidative stability is better thanthat of soybean lecithins 5 for egg yolk phospholipids saturated fatty acid is usually at sn1 position and unsaturated fattyacid is at sn2 position 9 while for soybean lecithin sn1 andsn2 position can be both unsaturated fatty acids', ' for exampledilinoleoylphosphatidylcholine dlpc is the main componentof soybean phosphatidylcholine spc 20', 'the cost of phospholipids isolated from natural sources isalways lower than that obtained by synthetic or semisynthetic methods', ' for natural phospholipids the morepure they are the higher the price is 9', 'phospholipids isolated from plants and animals can bepurified into different levels including food and pharmaceutical grade', ' for example lipoid e80 can contain pc pe lysophosphatidylcholine lpc lysophosphatidylethanolaminelpe sm and trace amounts of triglycerides cholesterol fattyacid d lavitamin e and water 21', '2', '2', '2', 'synthetic phospholipidssince chromatographic purification techniques still cannotget single component of naturally occurring phospholipidsresearchers focus on chemical synthesis which can obtainsingle component with defined structure and configuration22', ' the synthesis of phospholipids can be divided into semisynthesis and total synthesis', 'semisynthesis of glycerophospholipids refers to thechanging of head tail groups or both on the basis of naturalphospholipids', ' therefore compared with the total synthesisit requires less reaction steps', ' the semisynthetic methods ofglycerophospholipids mainly include 1 the double bonds ofnatural phospholipids are hydrogenated to obtain the saturated phospholipids which have a higher melting point andoxidationstability2acylationofsnglycero3phosphocholine gpc obtained by deacylation of natural pcwith activated acyl derivative can get the desired pc 3phospholipase d catalyzes glycerophospholipids to generatethe phosphatidic acid pa and the hydroxycontaining acceptors such as glycerol and serine can attach to pa whichcan converse the choline head group into various phosphorylated alcohol head groups 9', 'the total synthesis of glycerophospholipids involves theformation of ester or ether bonds linking apolar moieties toglycerol backbone and the attachement of polar head group', 'ispropylidene glycerols or sugar alcohols such as dmannitolare often served as the precursors of glycerol part of phospholipids which are available from many sources', ' the synthetic glycerophospholipids have the advantages of singlecomponent and stable property 9', 'the procedure of semisynthesis of sm involves thedeacylation of the natural sm extracts primarily from bovinebrains to obtain the sphingosylphospocholine which is subsequently acylated to sm using the fatty acid of choice', ' it hasbeen found that during the deacylationreacylation procedure a significant amount of the lthreo stereoisomer isformed', ' thus the final product represents a mixture ofderythro and lthreo stereoiomers 23', 'because the total synthesis of sm is considerably morecomplex than that of the glycerophospholipids there is fewstudies on the fully synthetic and stereochemically pure sm23', 'the access to synthetic sm is limited by the availability ofsynthetic sphingosine', ' following the total synthesis ofsphingosine 24 the first synthetic sm was synthesized byshapiro et al 25', ' the complete synthesis of sm includes thefollowing steps 1 the synthesis of sphingosine 2 the synthesis of ceramide nacylsphingosine 3 the synthesis of sm', '2', '3', 'the physiological properties of phospholipidsphospholipids are basic substances to maintain life activity', 'they are widely distributed in humans animals plants andso on', ' phospholipids are indispensable components of allcellular and subcellular membranes they can arrange asbilayer membranes', ' in addition to assembling the membranephospholipids are also used to assemble the circulating lipoproteins the main task of which is to transport lipophilic triglycerides and cholesterols through the hydrophilic blood', 'the human body uses phospholipids as emulsifiers', ' togetherwith cholesterols and bile acids they form mixed micelles inthe gallbladder to promote the absorption of fatsoluble substances', ' the human body also uses phospholipids as thesurfaceactive wetting agents in the pleura and alveoli of lungpericardium joints etc 26', 'different kinds of phospholipids have some general properties but they also own their unique physiological functionstable 2', '2', '4', 'the physical properties of phospholipids2', '4', '1', 'phospholipid polymorphisms in waterphospholipids in water can form many kinds of assembliessuch as micelles liposomes and hexagonal hii phase whichis attributed to the molecular shapes of the phospholipids', 'the assemblies and molecular shapes of different phospholipids in water are summarized in table 3 1', ' understandingthe lipid polymorphisms is necessary for establishing a stablecarrier and triggered release lipidbased delivery system', '2', '4', '2', 'factors modulating lipid polymorphismsnonbilayer lipids such as unsaturated pe can be stabilized ina bilayer structure by the presence of bilayer preferring lipidsphysiological propertiesa', ' an important substrate of synthesis of the neurotransmitter acetylcholine and having the function of nourishingthe brain and improving intelligence 27', 'a', ' playing an important role in membrane fusion 28', 'a', ' improving function of nerve cells regulating the conduction of nerve impulse and enhancing the memoryfunction of brain 29', 'b', ' the common feature of apoptosis 30', 'c', ' the main acidic phospholipids of membranes of platelets and involved in the clotting process 31', 'a', ' the precursor of second messenger which plays a very important role in the process of transmission of messagesin neural system 32', 'a', ' a phospholipid of unusual structure is localized almost exclusively to inner mitochondrial membrane is particularlyrich in unsaturated fatty acids', ' this phospholipid plays an important role in mitochondrial bioenergetics by affecting theactivity of key proteins of mitochondrial inner membrane 33', 'a', ' along with cholesterol constituting the key components of the stable detergentresistant nanodomains inmembranes called functional lipid rafts which have been identified as the important membrane structure of signaltransduction protein transport and sorting of membrane components 34', 'such as ps', ' it is usually found that between 20 and 50 mol ofthe bilayer preferring lipids are required to maintain a netbilayer organization when mixed with hii preferring lipidssuch as pe', ' the structural preferences of these pure andmixed lipid systems can be modulated by a wide variety offactors such as head group size temperature hydrocarbonunsaturation ionic strength ph the incorporation of invertedcone molecules and the presence of divalent cations such asca2þ 35', '1 the smaller head group of pe as compared to pc isconsistent with hii organization', ' in addition in the caseof pe increasing acyl chain unsaturation temperatureand acyl chain length lead to increased cone shape andpossible hii phase formation 35', ' the lamellar to hiitransition temperature tbh decreases with theincreasing chain length and the increasing unsaturation of acyl chain of pe', ' many species of naturallyoccurring pe preferentially adopt a hii phase atphysiological temperatures', ' in terms of tbh for varioussynthetic and naturally derived pe the readers can referto tilcocks review 36', '2 the hydration of the head group can modulate thepolymorphisms', ' for pe decreasing the water content orincreasing the ionic strength leads to increasedproclivity for hii structure', ' in addition under the condition of high salt concentration unsaturated pg cland pa can adopt hii phase 36', '3 in the case of pure lipid systems for example protonation of the ps carboxyl and pa phosphate at low phvalues leads to hii structure 3738', ' similar observationsextend to mixed lipid systems where bilayerhii transitions are observed for pspe and pape systems as theph is reduced below 5 as such ph values convert the paand ps to hii preferring lipid species 39', '4 conventional liposomes as drug carriers are avidlytaken up by the mononuclear phagocyte system mpsso in order to increase the circulation time of liposomesin vivo researchers focus on studying the longcirculating liposomes', ' the study for a synthetic lipidthat can extend circulation times finally gives rise to thedevelopment of polymer grafted bilayers', ' several polymer lipids lead to prolonged circulation times but themost well studied are those consisting of polyethyleneglycol peg grafted onto pe fig', ' 2 40', ' forinstance dspepeg2000 is a pegylated phospholipidwhich is widely applied in various preparations andpeg layer usually serves as a steric barrier to stabilizethe molecule assemblies among them', ' nanostructuresbased on dspepeg2000 play an important role in dds', 'for instance dspepeg2000 is used in the fda approveddrug product doxil 4', 'however the concentration of pepeg derivatives canaffect the structures and properties of liposomes', ' forphospholipidpeg conjugates the larger the size of theattached peg is the more wedgeshaped the phospholipidpeg is', ' thus the cone shaped phospholipidpeg2000 andphospholipidpeg5000 molecules form micelles in solution andthey can convert dspc bilayer to micelles at highphospholipidpeg concentrations', ' in contrast phospholipidpeg350 is able to separate pc head groups enough to causeinterdigitation at high concentrations but not enough tocause micelles formation even in dispersions containing purephospholipidpeg350', ' phospholipidpeg750 has an intermediate shape so that when added to dspc it induces interdigitated bilayers at moderate concentrations and mixed micellesat higher concentrations 41', 'the experimental results of johnsson et al', ' showed that thestructural evolution of aggregates formed in this system withincreasing phospholipidpeg peg molecular weight 2000 or5000concentrationcanbesummarizedasliposomes  discoidal micelles  spherical micelles 42', 'unlike dppc and dspc the mixtures of epc and phospholipidpeg form cylindrical micelles rather than discoidal micelles43', ' moreover the addition of phospholipidpeg to dope isable to facilitate liposomes formation at physiological conditions fig', ' 3', ' the observations of johnsson et al', ' showed thatin order to obtain a dispersed phase consisting of only liposomes predominantly unilamellar 8 mol phospholipidpeg2000 and greater than 10 mol of phospholipidpeg750 mustbe added to the dope system at physiological conditions', 'when the concentration of phospholipidpeg beyond bilayersaturating concentration small disks and spherical micellesformed 44', 'when the concentration of pepeg derivatives exceeds10 mol a large portion of discoidal or cylindrical micellesstructures formed which have no effect on the delivery forwatersoluble drugs', ' to reach the target site liposomes mustnot only possess a long circulation time but also maintain theencapsulated drugs', ' therefore these two factors must betaken into consideration to choose the most appropriateconcentration of pepeg derivatives 40', '5 in 1974 verkleij et al', ' 45 observed cylindrical lipidstructures using dilauryl phosphatidylglycerol with theaddition of ca2þ by freezeetch electron microscopy', ' thestructure were also observed in the presence of mg2þ 46', 'in 1975 papahadjopoulos et al', ' 47 observed the fusionof small unilamellar ps liposomes in the presence of ca2þby negative staining electron microscopy and theyobserved the fusion of sonicated ps vesicles with ca2þ toform rolledup cylindrical structures which were namedas cochleate cylinders by freezefracture electron microscopy 48', ' negatively charged phospholipids such aspa ps pg and pi can serve as the main building blocks ofcochleates', ' in addition mixture the negatively phospholipids with other phospholipids can also form cochleates for example vesicles prepared from pspcps  50 in the presence of ca2þ can form cochleateswhich needs higher threshold concentration of ca2þ4749', ' for cochleates the molar ratio of divalent cationsand phospholipids is 12', ' ca2þ maintains the cochleate inits rolled form and bridges each successive layerthrough ionic interaction 48 fig', ' 4', ' moreoverremoving the calcium by chelation with edta leads tothe cochleates unrolling and spontaneously forminglarge singlebilayer vesicles 48 fig', ' 5', 'in the case of pure lipid systems for ps ca2þ inducescrystalline cochleate structure whereas cl can adopt hiiphase in the presence of ca2þ 50', ' and for other acidicphospholipids such as pa pg and pi their structures on hydration may be sensitive to the fatty acid composition forexample cochleate structure can be observed for saturatedspecies in the presence of ca2þ however unsaturated paadopt hii phase 51 and unsaturated pg and pi still prefer abilayer organization by the addition of ca2þ 5253', 'in the case of mixed systems it has been proved thatmixtures of acidic phospholipids such as ps cl pa and pgwith unsaturated hii phase pe are sensitive to the presence ofca2þ and in some cases mg2þ which can trigger bilayer to hiiphase transitions', ' in systems stabilized by cl and pa ca2þcan convert the cl and pa to hii preferring species thusallowing the entire mixture to adopt the hii phase', ' this contrasts with systems stabilized by ps where ca2þ segregatesthe ps into cochleate domains allowing the pe to revert tothe hii phase it prefers in isolation', ' alternatively in pe systems stabilized by up to 30 mol unsaturated pg ca2þ appears to reduce the bilayer stabilizing capacity of pg and bothpg and pe enter the hii configuration', ' however the behaviorof systems stabilized by pi suggests that none of thesemechanisms apply', ' nayar et al', ' suggested that to a limitedextent ca2þ is able to segregate pi in these mixed systemswhere the pica2þ aggregates remain in a hydrated lamellarstructure 53', ' an inability of ca2þ to induce a cochleatestructure for pg 52 pi 53 and pa 51 may arise in part fromthe relatively unsaturated nature of the acyl chains', '2', '4', '3', 'the phase transition temperature of phospholipidsthe tc of phospholipids is a temperature at which phospholipids transit from gel to liquid crystalline state', ' many factorsaffect the tc', ' 1 the nature of the polar head group', ' pc and pgwith the same hydrocarbon chains have similar tc but thecorresponding pe has a higher tc', ' for example the tc of dppcand dppg are both 41  c whereas dppe is 63  c which isattributed to a stronger head group interaction', ' 2 the lengthof the hydrocarbon chains', ' phospholipids with longer hydrocarbon chains have a higher tc than those with shorter ones', 'for example the tc of dspc is 55  c and yet dppc is 41  c', ' 3the degree of saturation of the hydrocarbon chains', ' forphospholipids with the same head group and length ofaliphatic chain high saturation in the hydrocarbon chainsincreases the tc', ' for example the tc of dspc is 55  c whereasdopc is 20  c', ' 4 purity', ' the low purity of phospholipidswiden the range of tc', ' naturally occurring phospholipids areusually mixtures of components having different length hydrocarbon chains', ' such mixtures would usually be expectedto produce broad ill defined transitions but the synthetiphospholipids usually have definite tc', ' for example the tc ofspc is 20 to 30  c whereas dlpc is 20  c 54', ' table 4summarizes the tc of commonly used phospholipids', 'when chosing the phospholipids as carrier materialsmany factors must be taken into comprehensive consideration to select a kind of phospholipid with appropriate tc', 'the development of liposomal drug delivery systemliposomes are vesicles prepared with phospholipids as themain substance the structure of which is similar to cellularmembrane', ' liposomes origined from multilaminar vesicleswhich were clearly taken on morphosis by electron microscope images observed by bangham and horne in 1964 58', ' in1965 bangham et al', ' reported biomembrane model systemwhich was established based on vesicle structures and hadion gradient 59', ' in 1971 gregoriadis et al', ' first used liposomes to deliver bioactive substances 60', ' after that liposomes in drug delivery field flourish', ' in 1990 the firstinjectable liposomal drugamphotericin b liposome ambisome was available in europe 61', ' in 1995 the first liposomal anticancer drug doxil which is also the first fdaapproved nanomedicine was on the market in the usa 4', 'liposomes as carriers of therapeutic drugs have attractedattention more than 40 years', ' as a dds liposomes have manyadvantages as follows delivering both hydrophilic and lipophilic drugs fig', ' 6 possessing targeting controlled releaseproperties cell affinity tissue compatibility reducing drugtoxicity and improving drug stability', ' during the researchesthe conventional structures of the liposomes have somechanges which have brought out a series of new type liposomes such as longcirculating liposomes stimuliresponsiveliposomes cationic liposomes and ligandtargeted liposomes', 'liposomes can serve as the carriers of antitumor drugs antifungal drugs analgesic drugs gene therapeutics and vaccinesand there have been some liposomal formulations industrialized which are listed in table 5', '3', '1', '2', ' considering a variety of factors to select theappropriate phospholipid to prepare liposomes1 synthetic and natural phospholipids have both advantages and disadvantages', ' the advantages of syntheticphospholipids are that the property is relatively stableand purity is relatively high the drawback is that theprice is relatively high', ' however the advantage of natural phospholipids is that the price is relatively low thedisadvantages are that the purity is difficult to controland the nature is relatively unstable which can bemetabolized to lysophospholipids in the process ofusage and storage', ' so the source should be consideredwhen choosing natural phospholipids to prepare theliposomes', ' for example the content of unsaturatedfatty acids in soybean phospholipids is higher than thatin egg yolk phospholipids', ' therefore it is difficult toobtain quality controlled liposomes product using soybean lecithins 63', ' in addition wang et al', ' studied therelationship between drug carrying ability of liposomesand pcs', ' the results showed that the encapsulationefficiency of epc liposomes was higher than that of spcliposomes and the leakage rate was lower than that ofspc liposomes so epc liposomes had better drug carrying ability 64', 'based on the above advantages of epc the current listingliposomes prepared by natural phospholipids are substantially composed of epc table 5', '2 phsensitive liposomes', ' in order to make the drugsescape from being degradated into inactive compoundsby enzymes in lysosomes after endocytosis usually phsensitive liposomes are prepared', ' dope is usuallyselected to prepare phsensitive liposomes howeverwhich is found to suffer from their difficulty to form liposomes by themselves', ' so in order to form stable liposomes materials containing titratable acidic groupsmust be added to dope', ' the liposomes established bythe above membrane materials have phsensitivitybecause at neutral ph the fatty acid carboxyl ion canprovide effective electrostatic repulsion which makesthe liposomes stable at lamellar phase and at acidic phfatty acid carboxyl groups are protonated causing theformation of the hii phase which makes the liposomesunstable and easy to aggregate fuse and release thecontents 65', ' in addition compared with other phospholipids liposomes formed by pe contribute to themembrane fusion which is because of the low hydrationof the polar head of pe 66', ' thus the presence of dopecan increase the hydrophobicity of liposomal membrane and promote its interaction with the lipid bilayer', 'to increase the stability of phsensitive liposomes thestructures have undergone a series of changes includinglongcirculating dopecontaining phsensitive liposomes andassociation of phsensitive polymers with liposomes', ' addingdspepeg to dope liposomes is not only able to promote theformation of dope liposomes but also can increase the circulation time of liposomes in vivo 44', ' another method forconferring the liposomes with phsensitivity is to anchor thephsensitive polymers to liposomes', ' the principle is beyoundthe scope of this review', '3 thermosensitive liposomes temperaturesensitiveliposomes are very promising strategies for cancertreatment which effectively utilize the dual advantagesof liposomes and hyperthermia to improve the therapeutic effects and reduce toxicity', 'in 1978 yatvin et al', ' were the first to realize the therapeuticpotential of liposomes which are composed of phospholipidsthat can be achieved tc higher than the physiological temperature but below 42  c by gentle heating 67', ' liposomeshave a characteristic tc at which the liposome membranestransit from the gel phase to liquid crystalline phase and theencapsulated drugs are released from the vesicles 67', 'the early thermosensitive liposomes are mainly based ondppc tc ¼ 41  c', ' although pure dppc liposomes can increasedrug release the amount and rate of release are relatively low', 'adding other phospholipids mainly dspc and hspc to dppcwould have a positive impact on the amount and rate of drugrelease 68', ' however the tc of liposomes composed of dppcdspc are enhanced', ' furthermore dspc added increases thespan of tc', ' as a result only 43e45  c can trigger the release ofdrugs but this range can make normal tissue surrounding thetumor at the risk of necrosis', ' therefore it is necessary to finda way that gentle heating 39e42  c can promote the releaseof drugs and simultaneously keep burst relase 68', 'in 1999 anyarambhatla and needham proposed thatincorporating 10 mol lysolipid monopalmitoyl phosphocholine mpps into the pegylated conventional thermosensitive liposomes composed of dppc could make the tcreduce from 43  c to 39e40  c and enhance the release ofdrugs upon heating approximately 50 of drugs will bereleased at 40  c for 20 s fig', ' 7 69', ' thermodox is alysophospholipidcontainingthermosensitiveliposomewhich is developed by celsion company', ' unfortunately thecombination of thermodox and radiofrequency thermalablation rfa did not significantly improve the therapeuticeffects in third period clinical trials', ' there are many reasonsfor the failure one of which is that drugs loading in thermodox are easy to leak leading to the loss of drugs beforereaching the target site', ' another important reason is thatmost drugs do not reach the target site causing failure togenerate substantial trigger release', ' therefore in order toachieve the desired effect the lipid composition should befurther changed 70', 'another method for preparing thermosensitive liposomesis to incorporate heatsensitive polymers in liposomes', ' thetemperature sensitivity of such liposomes are mainly dependent on the temperaturesensitive polymers', ' moreover dppcincorporated to the thermal thermosensitive liposomes canachieve a synergistic effect with the polymers 71', '4 the types of phospholipids can also affect the deliveryefficiency of drugs', 'there is evidence that the composition of liposomesmarkedly contributes to their ability to escape recognition bythe mps', ' liposomes that resemble the exterior layer oferythrocytes in composition are particularly resistant toclearance 72', ' in erythrocytes pc and sm are mainly in theexterior layer whereas the pe and ps are restricted to theinterior layer 73', ' moreover the fatty acyl chains of phospholipids in the outer layer are more highly saturated thanthat in the interior layer 74', ' evidence showed that the loss ofphospholipid asymmetry of erythrocytes might be translatedinto a signal of recognition by macrophages', ' this result notonly provides a guideline for understanding the behavior ofliposomes in vivo but also provides a reference for the designof liposome dds', 'it has been observed that liposomes containing negativelycharged phospholipids such as ps pg and pa can be quicklyeliminated from the circulation system and focused on themps 72', ' in contrast liposomes containing negatively chargedganglioside gm1 and pi are able to inhibit the uptake by themps and prolong the circulating time 75', ' therefore clearance rate can not be fully explained by negative charge', ' allen76 proposed that the hydrophilicity on the surface can play avery important role in phagocytosis of particles', 'in addition membrane fluidity can also affect the circulation time of the liposomes', ' increasing the rigidity of liposomesby incorporating phospholipids with high tc e', 'g', ' dspc andmore rigid phospholipids like sm can reduce their clearanceby the mps 75', ' adding sm in liposomal formulation can notonly decrease the distribution of liposomes to the mps 77but also stabilize the membrane structure 78', ' the fatty chainis connected to the skeleton via an amide bond in sm molecule while in the glycerophospholipids the aliphatic chainsare connected to the skeleton of the molecule via an esterbond', ' in vivo the amide bond is difficult to be hydrolyzed anddegraded by enzymes than the ester bond so an amide bond ismore stable than an ester bond', ' furthermore sm can formintermolecular hydrogen bonds so it also has the effect ofsolidifying the bilayer 79', ' the successful application of liposomes prepared by sm is marqibo 4', 'therefore we can select the phospholipids to prepare liposomes according to the site of disease', ' when the sites ofdiseases are in the mps the majority of liposomes need to beremoved from the blood circulation within minutes to exerttherapeutic effects', ' so in order to make drugs target to themps conventional liposomes i', 'e', ' liposomes composed ofvarious phospholipids and cholesterol and possibly otherlipids without specific components conferring the property oflong circulation in blood can be prepared', ' however the rapidelimination of liposomes has thus far been an obstacle fortransporting drugs to the sites of diseases beyond the mpssuch as some tumors', ' so in order to enhance the circulationtime long circulation liposomes can be prepared 80', '5 accelerated blood clearace phenomenon', 'fig', ' 7 e schematic of the lysolipidcontainingthermosensitive liposome', 'when pegylated liposomes are repeatedly injected into thesame animal the second dose of liposomes would rapidly becleared from the bloodstream and accumulated in liver andspleen and this phenomenon is called accelerated bloodclearance abc', ' there are many factors known to influenceabc phenomenon in this review we mainly focus on the effects of types and dose of phospholipids', ' 1 the effect of thedose of phospholipids on the abc phenomenon is differentwith the variation of phospholipids types for example whenthe first phospholipids dose of pegylated liposomes composedof hydrogenated egg phosphatidylcholine hepc is larger than1 mmolkg in rats the second injection of pegylated liposomescannot induce the abc phenomenon 81 however whenliposomes are composed of partially hydrogenated egg phosphatidylcholine phepc intravenous injection of differentphospholipids doses of pegylated liposomes i', 'e', ' 0', '05 0', '5 or5 mmolkg as a first dose can cause the second specific dose5 mmolkg of injected pegylated liposomes to induce the abcphenomenon 82', ' in addition the magnitude of abc phenomenon is different when lipsomes composed of the samephospholipid which could be reduced by the increasing ofphospholipids dose 8182', ' 2 phospholipids can also affect themagnitude of abc phenomenon', ' xu et al', ' demonstrated thatabc phenomenon of liposomes prepared by unsaturatedphospholipids spc epc and esm was more obvious than thatof saturated phospholipids dppc and hspc 83', 'in addition depth study showed that peg is not necessaryfor the generaion of abc phenomenon for liposomes', ' laverman et al', ' 82 demonstrated that conventional liposomes canalso accelerate blood clearance of the second injection ofconventional or pegylated liposomes', ' unlike pegylated liposomes the results of ishida et al', ' showed that a high dose5 mmolkg of conventional liposomes without a pegcoatingcan induce the same phenomenon while a low lipid dose0', '001 mmolkg did not 81', '3', '2', 'intravenous lipid emulsionsintravenous emulsions are originated from the developmentof intravenous nutrition emulsions', ' in 1962 intralipid wassuccessfully developed in sweden and proved to be safe andeffective which lay the foundation for the development ofmedicinal intravenous emulsions 84', ' intravenous fat emulsions possess many advantages including targeting reducingdrug toxicity which make them attract more and more attentions recently', 'phospholipids as zwitterionic surfactants can be used asemulsifying agent of ow type emulsions and due to theirbiological and nontoxic characteristics they can be used asemulsifiers for intravenous injection 2', ' the ow type emulsions are mainly composed of two parts the oil core and theemulsifying agents on the surface', ' unlike liposomes fatemulsions are suitable for largescale industrial productionand relatively stable below 25  c for long term', ' moreimportantly a large quantity of lipophilic drugs can be dissolved in the hydrophobic core of emulsions 85', 'currently the listed drug containing injectable emulsionsusing phospholipids as an emulsifier are summarized intable 6 5', ' the main disadvantage of phospholipids asemulsifiers is that in the process of emulsification sterilization and storage natural lecithins are readily hydrolyzed togenerate lysophospholipids which can lead to hemolysis afterintravenous injection', ' phospholipid mixtures derived fromthe egg yolk of birds and soybean have stronger emulsifyingability than single component', ' however using purified lecithins 86 can reduce the generation of lysophospholipids', ' thephysical nature of lecithins and the resulting emulsion stability are changing a lot depending on the sources and thedegrees of purification of the emulsifiers', 'the component of pc determines the surface properties offat emulsions and also affects their distribution in the body', 'lenzo et al', ' studied the in vivo behavior of emulsions usingepc dopc dmpc dppc and 1palmitoyl2oleoyl phosphatidylcholine popc as an emulsifier', ' in that study emulsionswere prepared in the size of about 150 nm and the elimination rate in rat plasma mainly depended on the types ofphospholipids', ' when these emulsions were injected into theblood of conscious rats the elimination rate of formulationsusing dppc as an emulsifier was the slowest', ' the fat emulsions stabilized by epc and popc were metabolized similarlyto natural chylomicrons', ' the triacylglycerols were rapidlyhydrolyzed by lipoprotein lipase lpl followed by the remnants derived from the emulsions was taken up by liver', 'phospholipids from the injected emulsions were removedmore slowly and became associated with the highdensitylipoprotein hdl fractions of the plasma', ' emulsions containing dppc were metabolized differently', ' the triacylglycerols were eliminated very slowly from plasmawhich indicated that lpl hydrolysis did not occur andphospholipids were not transferred to the hdl', ' for theemulsions containing dmpc the triacylglycerols andcholesterol esters of emulsion were eliminated very fast butphospholipids were not transferred to the hdl', ' for dopcemulsions clearances were slower than epc and popcemulsions but it was effectively transferred to the hdl 87', 'redgrave et al', ' showed that the clearances of dspcstabilizedfat emulsions from the plasma were faster than the dppcstabilized fat emulsions', ' although dspc fat emulsions canhardly be hydrolyzed by lpl it can be avidly taken up by themacrophages in liver and spleen which is different from theliposomes prepared by dspc 88', 'sm is a very important component of lipoproteins surfaceand the surface concentration of sm plays an important role inmetabolism and distribution of emulsions', ' redgrave et al', ' 88observed that adding sm to emulsions caused the prolongation of circulation time in plasma and the reduction of uptakeby liver which are attributed to the decrease of binding ofapolipoprotein e and the reduction of lplmediated lipolysisinduced by sm', 'recently in order to increase the circulation time ofintravenous emulsions fig', ' 8a and enhance the antitumoreffect of drugs pegylated derivatives as emulsifiers are usually added to prepare longcirculating emulsions fig', ' 8b', 'these effects of peg derivatives can be attributed to the increase of hydrophilicity and steric stability of the emulsionsurface 80', ' however repeated injections of pegylatedemulsions can also induce the abc phenomenon 89 and thefactors related to phospholipids affecting it still need indepthstudy', '3', '3', 'micellesthe applications of phospholipids in micelle systems mainlyinclude pcbile salt mixed micelles and phospholipid micelles', '3', '3', '1', 'pcbile salt mixed micellesin classical mixed micelles mms waterinsoluble phospholipid molecules combine with another surfactant such as bilesalt bs to form mms and the hydrophobic core of mm canencapsulate poorly soluble drugs 90', ' insoluble drugsdispersed in mms in molecular state can improve theirbioavailability', ' phospholipids can form mms with multiplesubstances and pcbs mms have entered into pharmaceuticaldrug market', 'bs detergentlike chemicals produced by liver and storedin the gallbladder are able to solubilize pc to a large extentand form a clear mms solution which promotes the adsorptionof fatsoluble substances', ' therefore pcbs mms serve as acarrier that can greatly improve solubility of poorly solubledrugs', ' in addition the results of a previous research showedthat pc can protect against plasma membrane disruption bybs 91', 'valium and konakion representing the classical mmsystem prepared by spc and glycocholic acid are two mmpreparations which can be available in currently medicalmarket 6', ' intravenous injection of these mms exhibits goodstability and compatibity 92', 'there are two essentially different types of pcbs mmswhich is dependent on the ratio of bs and pc', ' when bs lecithin molar ratios are less than approximately 21 lamellarparticles similar to a lecithin bilayer arrangement are foundfig', ' 9a', ' when molar ratios exceed 21 a different type ofmicelle structure is found', ' this is a highly isometrical particleof globular shape fig', ' 9b probably having a centrosymmetricarrangement of the molecular constituents 93', ' therefore adrawback of pcbs mms is that a change in the lecithinbsratio or in the total concentration leads to a change in the mmsize and structure 94', '3', '3', '2', 'phospholipid micellesin 1994 it was observed that pepeg molecules are able toform micelles in an aqueous environment 95 fig', ' 10', ' whentrying to prepare longcirculating liposomes phoshpholipidepeepeg mixtures could form micelles rather than liposomes if peepeg content exceeds certain critical limit 40', 'this phenomenon is considered as a nuisance until it isrealized that pepeg molecules can aggregate to form sterically stabilized micelles ssms which have potential as aparticulate carrier to deliver poorly watersoluble therapeutics especially anticancer molecules 96', ' in pepeg micellestwo fatty acyl chains of the phospholipid residues make hydrophobic interaction of micellar core stronger which leads tohigher stability of micelles and peg residue exposed on thesurface can avert the uptake by the mps which can prolongthe circulating time of micelles 97', 'the saturation level of pe has an effect on the circulatinghalflife of the micelles', ' anatoly et al', ' demonstrated thatreplacing dspe that is lipid component of pepeg with dope toform micelles can reduce the circulating halflife 98', 'fig', ' 9 e molecular models for the lecithinrich type of mixed micelles a and for the bile saltrich type b', ' the bile salts arethought to form pairs to avoid contact of the hydroxyl groups solid circles with the apolar environment', 'although the ssms have many advantages they alsohave drawbacks one of which is the limited solubilizationcapability for poorly soluble drugs', ' in some cases toimprove drug solubilization additional micelleformingcompounds can be added to peepeg micelles to form mms', 'epc is added to the micelle composition to form stericallystabilized mixed micelles ssmms 99', ' insertion of a smallpercentage of epc into a pepeg micellar system is able toincrease the volume of the hydrophobic region of micelles', 'this would therefore provide a larger space for the hydrophobic drugs to be solubilized', ' the results showed that thessmms approximately double the paclitaxel encapsulationefficiency 99', 'the addition of epc into the micelle composition is able toincrease the encapsulation efficiency of paclitaxel but whenepc content exceeds certain critical limit cylindrical micellesbegin to dominate and the solubilization potential for drugsdecreases 100', 'kaminskas et al', ' studied the abc phenomenon of pegylated micelles and liposomes', ' the results demonstrated thatalthough peg micelles could stimulate production of antipegigm which led to accelerated clearance of subsequentlyadministered pegylated liposomes', ' but the second injectionof pegylated micelles were not substrates for igm binding anddid not exhibit a similar abc phenomenon 101', 'drugphospholipid complexesmany synthetic and herbal drugs possess the problem of poororal bioavailability and the reason is their very low watersolubility or poor permeation through the biological membrane', ' poorly soluble drugs have suffered from low bioavailability and inefficacy in therapy due to their low dissolutionprofile in biological fluid', ' without a proper level of drug concentration in the gastrointestinal gi fluid the drugs cannotbe effectively transported by the epithelia of the gi tractresulting in low systemic absorption 102', ' however althoughmost bioactive molecules of plants are biologically polar orwatersoluble they are difficult to pass through the lipidrichbiological membrane and be absorbed by human the reasonsof which include 1 large molecular weight 2 low lipid solubility 103', 'when studied liposomes bombardelli et al', ' stumbled thatnatural flavonoids have a special affinity for phospholipidsand they can combine to form complexes which exhibitmarkedly different biological properties and pharmacologicalactivities from parent drugs 104', ' thereafter the drugphospholipid complexes aptly called as phytosomes gradually attracted peoples attention and their studies areincreasing', ' later researchers found that many types of naturalingredients and natural extracts can be made from phospholipid complexes', ' the interaction had been attributed to theformation of hydrogen bonds andor hydrophobic interactions between the two molecules 105', 'phytosomes are characterized by amphiphilicity whichmakes them have not only better dissolution in the gi fluid butalso better absorption through the lipophilic membrane system or tissue', ' drugphospholipid complexes can improve thebioavailability of parent drugs which have either very low lipidsolubility or very poor water solubility', ' therefore both kindsof drugs can be complexed for improving biopharmaceuticalproperties 106', ' in addition to improving the drug absorptiondrugphospholipid complexes also have the following advantages 1 increasing the stability of drugs 2 prolonging theduration of action of drugs 7', 'when treated with water phytosomes form liposomelikestructures fig', ' 11a', ' however there are many differencesbetween phytosomes and liposomes mainly including 1 thesize of liposomes is much bigger than that of phytosomes 2there is the formation of new bonds in phytosomes whereasno chemical bond is formed in liposomes 3 in liposomesthere are hundreds or thousands of pc molecules surroundingthe watersoluble compounds', ' conversely the molar ratio ofpc and natural ingredients is 11 or 21 for phytosomes whichdepends on the chemical bondforming material 4 the natural active ingredients are dissolved in the medium or wrapped by the membrane in liposomes while in phytosomes theactive principle is anchored through the chemical bond to thepolar head of phospholipids 107 fig', ' 11b', 'in recent years the reports about phospholipid complexesof natural active ingredients are gradually increasing', ' inabroad there have been dozens of phytosome products suchas silybin phytosome ginkgo phytosome and ginsengphytosome 7', '3', '5', '112', ' cochleates can be stored in a cationcontaining buffersolution for over 2 years at 4  c and at least a year at roomtemperature as a lyophilized powder 113', ' cochleates canbe lyophilized to a free flowing powder that can be incorporated in capsules for oral administration or redispersed inwater for injection 114', ' 3 ability to significantly improvedoral absorption of encochleated drug molecules 110', ' thisenhanced activity can be attributed to the membrane fusioncapability of cochleates which can be envisioned as membrane fusion intermediates in many naturally occurringmembrane fusion events 110115', ' the high tension ofedges of cochleates makes them interact with the tissuemembrane 110', ' 4 high safety', ' cochleates are usuallycomposed of ps and ca2þ which are derived from naturallyoccurring substances', ' ps has been used as a nutrient supplement which have a role in supporting the mental functions in aging brains 116', 'cochleatescochleates are a lipidbased macromolecular assembleshaving enormous potential in drug delivery', ' they havemany characteristics including 1 ability to deliver a varietyof drugs such as antifungal agents polypeptides proteinsvaccines oligonucleotides and genes 108', ' cochleates as adrug delivery platform are applicable to macromolecules aswell as small molecule drugs that are hydrophobic amphiphilic negatively charged positively charged which havepoor bioavailability 109 fig', ' 12', ' at first cochleates areformed by ionic interaction between negatively charged liposomes and bivalent cations subsequently syed et al', 'used cationic drugs themselves as the bridging agents andsuccessfully prepared the cochleates without adding anybivalent cations 110 fig', ' 12e', ' 2 high stability', ' there isevidence that drug molecules encochleated in the cochleatecylinders are present in the inner layers of a solid stablewater and oxygen impermeable structure which is capableof increasing the stability of drugs 111', ' the encochleateddrug molecules can remain intact even though the outermost layer of cochleates can be exposed to the harsh environmental condition or enzyme which contributes to theefficaciousness of cochleates for the oral delivery of drugs4', 'conclusionsin the material world applications are determined by properties which are essentially determined by structure', ' phospholipids are endogenous substances so understanding theirnature and physiological functions in vivo is very necessary forus to comprehend and design its application in drug deliveryplatform', ' for example from the distribution of phospholipidsin the cell membrane we can understand the circulation timeof liposome composed of different phospholipids in vivo', ' thediscussed examples show that phospholipids offer manifoldpossibilities to be used as excipients in dds which can deliverboth hydrophilic and lipophilic drugs', ' thus suitable carrierhave to be thoughtfully selected for every therapeutic', ' the applications of phospholipids in drug delivery are certainly notlimited to those described in the present article and there arestill other applications such as suspensions solid lipid nanoparticle and so on', ' in the future there will be a broad space forthe development of dds based on phospholipids', ' although thephospholipids have wide applications in dds they also facechallenges for instance liposomes and intravenous lipidemulsions have abc phenomenon', ' in sum the applications ofphospholipids in dds are the coexistence of opportunities andchallenges', '', '', '', '', '1 pt cullis de kruijff b', ' lipid polymorphism and thefunctional roles of lipids in biological membranes', ' biochimbiophys acta bba 19795594399e420', ' reviews onbiomembranes', '2 yang r zhang x li f et al', ' role of phospholipids andcopolymers in enhancing stability and controllingdegradation of intravenous lipid emulsions', ' colloid surf aphysicochem eng asp 20134360434e442', '3 haynes dh', ' phospholipidcoated microcrystals injectableformulations of waterinsoluble drugs m', ' google patents', '1992', '4 allen tm cullis pr', ' liposomal drug delivery systems fromconcept to clinical applications', ' adv drug deliv rev201365136e48', '5 hippalgaonkar k majumdar s kansara v', ' injectable lipidemulsionsdadvancements opportunities and challenges', 'aaps pharmscitech 20101141526e1540', '6 rupp c steckel h muller bw', ' solubilization of poorlywatersoluble drugs by mixed micelles based onhydrogenated phosphatidylcholine', ' int j pharm20103951272e280', '7 bhattacharya s', ' phytosomes the new technology forenhancement of bioavailability of botanicals andnutraceuticals', ' int j health res 200923225e232', '8 baer e pavanaram sk', ' nmethylcephalins i', ' synthesis ofdistearoyl laglycerylphosphorylnmethyl ethanolamine', 'j biol chem 196123651269e1272', '9 paltauf f hermetter a', ' phospholipidsdnaturalsemisynthetic syntheticm', ' phospholipids', ' springer 1990', 'p', ' 1e12', '10 stafford re dennis ea', ' lysophospholipids asbiosurfactants', ' colloids surf 198730147e64', '11 washington c', ' stability of lipid emulsions for drug delivery', 'adv drug deliv rev 1996202131e145', '12 barenholz y thompson t', ' sphingomyelins in bilayers andbiological membranes', ' biochim biophys acta bba1980604129e158', ' reviews on biomembranes', '13 mcintosh tj simon sa needham d et al', ' structure andcohesive properties of sphingomyelincholesterol bilayers', 'biochemistry 19923172012e2020', '14 barenholz y thompson te', ' sphingomyelin biophysicalaspects', ' chem phys lipids 1999102129e34', '15 baer e', ' from the trioses to the synthesis of naturalphospholipids a research trail of forty years', ' j am oil chemsoc 1965424257e266', '16 szuhaj bf', ' lecithins sources manufacture and uses', ' amoil chem soc 198912', '17 lecithin wendel a', ' kirkothmer encyclopedia of chemicaltechnology', ' 1995', '18 rossi m', ' use of lecithin and lecithin fractionsm', ' bioactiveegg compounds', ' springer 2007', ' p', ' 229e239', '19 hager a de paoli t ihlo j et al', ' stability study of lecithinliposomes during storage using esr', ' spectrochim acta a199349131999e2005', '20 terao j hirota y kawakatsu m et al', ' structural analysis ofhydroperoxides formed by oxidation of phosphatidylcholinewith singlet oxygen', ' lipids 1981166427e432', '21 pace g mishra ak snow ra et al', ' spray drying process ofcompositions containing fenofibrate m', ' ep patent1322289', ' 2007', '22 eibl h', ' synthesis of glycerophospholipids', ' chem phys lipids1980264405e429', '23 koynova r caffrey m', ' phases and phase transitions of thesphingolipids', ' biochim biophys acta bba 199512553213e236', ' lipids and lipid metabolism', '24 shapiro d segal k', ' the synthesis of sphingosine', ' j amchem soc 195476225894e5895', '25 shapiro d flowers h', ' studies on sphingolipids', ' vii', 'synthesis and configuration of natural sphingomyelins', ' jam chem soc 19628461047e1050', '26 kidd p', ' phospholipids versatile nutraceuticals forfunctional foods', ' functional ingredients', ' 2002', '27 little a levy r chuaquikidd p et al', ' a doubleblindplacebo controlled trial of highdose lecithin in alzheimersdisease', ' j neurol neurosurg psychiatry 1985488736e742', '28 dowhan w bogdanov m', ' functional roles of lipids inmembranes', ' new compr biochem 2002361e35', '29 pepeu g pepeu i amaducci l', ' a review ofphosphatidylserine pharmacological and clinical effects', ' isphosphatidylserine a drug for the ageing brain pharmacolres 199633273e80', '30 fadok va de cathelineau a daleke dl et al', ' loss ofphospholipid asymmetry and surface exposure ofphosphatidylserine is required for phagocytosis ofapoptotic cells by macrophages and fibroblasts', ' j biol chem200127621071e1077', '31 lentz br', ' exposure of platelet membranephosphatidylserine regulates blood coagulation', ' prog lipidres 2003425423e438', '32 bansal vs majerus pw', ' phosphatidylinositolderivedprecursors and signals', ' annu rev cell biol 19906141e67', '33 hoch fl', ' cardiolipins and biomembrane function', ' biochimbiophys acta bba 19921113171e133', ' reviews onbiomembranes', '34 chiu s vasudevan s jakobsson e et al', ' structure ofsphingomyelin bilayers a simulation study', ' biophys j20038563624e3635', '35 cullis pr hope mj tilcock cps', ' lipid polymorphism andthe roles of lipids in membranes', ' chem phys lipids1986402e4127e144', '36 tilcock cp', ' lipid polymorphism', ' chem phys lipids1986402109e125', '37 hope mj cullis pr', ' effects of divalent cations and ph onphosphatidylserine model membranes a 31p nmr study', 'biochem biophys res commun 1980923846e852', '38 farren sb hope mj cullis pr', ' polymorphic phasepreferences of phosphatidic acid a 31p and 2h nmr study', 'biochem biophys res commun 19831112675e682', '39 hope mj walker dc cullis pr', ' ca2þ and ph induced fusionof small unilamellar vesicles consisting ofphosphatidylethanolamine and negatively chargedphospholipids a freeze fracture study', ' biochem biophysres commun 1983110115e22', '40 edwards k johnsson m karlsson g et al', ' effect ofpolyethyleneglycolphospholipids on aggregate structure inpreparations of small unilamellar liposomes', ' biophys j1997731258e266', '41 kenworthy ak simon sa mcintosh tj', ' structure and phasebehavior of lipid suspensions containing phospholipidswith covalently attached poly ethylene glycol', ' biophys j19956851903e1920', '42 johnsson m edwards k', ' liposomes disks and sphericalmicelles aggregate structure in mixtures of gel phasephosphatidylcholines and poly ethylene glycolphospholipids', ' biophys j 20038563839e3847', '43 holland jw cullis pr madden td', ' poly ethyleneglycollipid conjugates promote bilayer formation inmixtures of nonbilayerforming lipids', ' biochemistry19963582610e2617', '44 johnsson m edwards k', ' phase behavior and aggregatestructure in mixtures of dioleoylphosphatidylethanolamineand poly ethylene glycollipids', ' biophys j2001801313e323', '45 verkleij a de kruyff b ververgaert p et al', ' the influence ofph ca2þ and protein on the thermotropic behaviour of thenegatively charged phospholipid phosphatidylglycerol', 'biochim biophys acta bba 19743393432e437', 'biomembranes', '46 ververgaert jt de kruyff b verkleij a et al', ' calorimetricand freezeetch study of the influence of mg2þ on thethermotropic behaviour of phosphatidylglycerol', ' chemphys lipids 197514197e101', '47 papahadjopoulos d poste g schaeffer b et al', ' membranefusion and molecular segregation in phospholipid vesicles', 'biochim biophys acta bba 1974352110e28', 'biomembranes', '48 papahadjopoulos d vail w jacobson k et al', ' cochleatelipid cylinders formation by fusion of unilamellar lipidvesicles', ' biochim biophys acta bba 19753943483e491', 'biomembranes', '49 duzgune n nir s wilschut j et al', ' calcium andmagnesiuminduced fusion of mixed phosphatidylserinephosphatidylcholine vesicles effect of ion binding', ' j membrbiol 1981592115e125', '50 vail wj stollery jg', ' phase changes of cardiolipin vesiclesmediated by divalent cations', ' biochim biophys acta bba1979551174e84', ' biomembranes', '51 graham i gagne j silvius jr', ' kinetics and thermodynamicsof calciuminduced lateral phase separations inphosphatidic acidcontaining bilayers', ' biochemistry198524257123e7131', '52 farren sb cullis pr', ' polymorphism ofphosphatidylglycerolphosphatidylethanolamine modelmembrane systems a 31p nmr study', ' biochem biophys rescommun 1980971182e191', 'a s i a n j o u r n a l o f p h a r m a c e u t i c a l s c i e n c e s 1 0  2 0 1 5  8 1 e9 853 nayar r schmid s hope m et al', ' structural preferences ofphosphatidylinositol and phosphatidylinositolphosphatidylethanolamine model membranes influence ofca2þand mg2þ', ' biochim biophys acta bba19826881169e176', ' biomembranes', '54 taylor km morris rm', ' thermal analysis of phase transitionbehaviour in liposomes', ' thermochim acta1995248289e301', '55 samad a sultana y aqil m', ' liposomal drug deliverysystems an update review', ' curr drug deliv200744297e305', '56 ikeda a kawai y kikuchi j et al', ' formation and regulationof fullereneincorporation in liposomes under the phasetransition temperature', ' org biomol chem2011982622e2627', '57 contreras fx sot j ruizarguello mb et al', ' cholesterolmodulation of sphingomyelinase activity at physiologicaltemperatures', ' chem phys lipids 20041302127e134', '58 bangham a horne r', ' negative staining of phospholipidsand their structural modification by surfaceactive agentsas observed in the electron microscope', ' j mol biol 196485', '660ein10', '59 bangham a standish m watkins j', ' diffusion of univalentions across the lamellae of swollen phospholipids', ' j mol biol1965131', ' 238ein27', '60 gregoriadis g leathwood p ryman be', ' enzyme entrapmentin liposomes', ' febs lett 197114295e99', '61 hann im prentice hg', ' lipidbased amphotericin b a reviewof the last 10 years of use', ' int j antimicrob agents2001173161e169', '62 fan y zhang q', ' development of liposomal formulationsfrom concept to clinical investigations', ' asian j pharm sci20138281e87', '63 nara e miyashita k ota t', ' oxidative stability of liposomesprepared from soybean pc chicken egg pc and salmon eggpc', ' biosci biotechnol biochem 199761101736', '64 wang jibo sun yanzeng', ' the relationship between drugcarrying ability of liposomes and phosphatidylcholines', 'fine chemicals 200825256e259', '65 simoes s slepushkin v duzgunes n et al', ' on themechanisms of internalization and intracellular deliverymediated by phsensitive liposomes', ' biochim biophys actabba 20011515123e37', ' biomembranes', '66 schroit aj madsen j nayar r', ' liposomecell interactionsin vitro discrimination of uptake mechanism and in vivotargeting strategies to mononuclear phagocytes', ' chem physlipids 1986402373e393', '67 yatvin mb weinstein jn dennis wh et al', ' design ofliposomes for enhanced local release of drugs byhyperthermia', ' science 197820243741290e1293', '68 gaber mh hong k huang sk et al', ' thermosensitivesterically stabilized liposomes formulation and in vitrostudies on mechanism of doxorubicin release by bovineserum and human plasma', ' pharm res199512101407e1416', '69 anyarambhatla gr needham d', ' enhancement of thephase transition permeability of dppc liposomes byincorporation of mppc a new temperaturesensitiveliposome for use with mild hyperthermia', ' j liposome res199994491e506', '70 oude blenke e mastrobattista e schiffelers rm', ' strategiesfor triggered drug release from tumor targeted liposomes', 'expert opin drug deliv 201310101399e1410', '71 kono k', ' thermosensitive polymermodified liposomes', ' advdrug deliv rev 2001533307e319', '72 allen t williamson p schlegel ra', ' phosphatidylserine as adeterminant of reticuloendothelial recognition of liposomemodels of the erythrocyte surface', ' proc natl acad sci198885218067e8071', 'zachowski a', ' phospholipids in animal eukaryoticmembranes transverse asymmetry and movement', 'biochem j london 19932941', 'mcevoy l williamson p schlegel ra', ' membranephospholipid asymmetry as a determinant of erythrocyterecognition by macrophages', ' proc natl acad sci198683103311e3315', 'allen tm hansen c rutledge j', ' liposomes with prolongedcirculation times factors affecting uptake byreticuloendothelial and other tissues', ' biochim biophys actabba 1989981127e35', ' biomembranes', 'allen tm', ' stealth liposomes five years on', ' j liposome res199223289e305', 'allen t chonn a', ' large unilamellar liposomes with lowuptake into the reticuloendothelial system', ' febs lett1987223142e46', 'webb m harasym t masin d et al', ' sphingomyelincholesterol liposomes significantly enhance thepharmacokinetic and therapeutic properties of vincristinein murine and human tumour models', ' b j cancer1995724896', 'allen tm', ' a study of phospholipid interactions betweenhighdensity lipoproteins and small unilamellar vesicles', 'biochim biophysica acta bba 19816402385e397', 'biomembranes', 'papahadjopoulos d allen t gabizon a et al', ' stericallystabilized liposomes improvements in pharmacokineticsand antitumor therapeutic efficacy', ' proc natl acad sci1991882411460e11464', 'ishida t harada m wang xy et al', ' accelerated bloodclearance of pegylated liposomes following precedingliposome injection effects of lipid dose and peg surfacedensity and chain length of the firstdose liposomes', ' jcontrol release 20051053305e317', 'laverman p carstens mg boerman oc et al', ' factorsaffecting the accelerated blood clearance of polyethyleneglycolliposomes upon repeated injection', ' j pharmacol expther 20012982607e612', 'xu h ye f hu m et al', ' influence of phospholipid types andanimal models on the accelerated blood clearancephenomenon of pegylated liposomes upon repeatedinjection', ' drug deliv 20141e10', 'wretlind a', ' development of fat emulsions', ' jpen j parenterenteral nutr 198053230e235', 'hansrani p davis s groves m', ' the preparation andproperties of sterile intravenous emulsions', ' pda j pharmsci tech julyeaugust 1983374145e150', ' pda j pharm scitechnol 198337 145e150', 'herman c groves m', ' hydrolysis kinetics of phospholipidsin thermally stressed intravenous lipid emulsionformulations', ' j pharm pharmacol 1992447539e542', 'lenzo np martins i mortimer bc et al', ' effects ofphospholipid composition on the metabolism oftriacylglycerol cholesteryl ester and phosphatidylcholinefrom lipid emulsions injected intravenously in rats', 'biochim biophys acta bba 19889601111e118', ' lipids andlipid metabolism', 'redgrave tg rakic v mortimer bc et al', ' effects ofsphingomyelin and phosphatidylcholine acyl chains on theclearance of triacylglycerolrich lipoproteins from plasma', 'studies with lipid emulsions in rats', ' biochim biophys actabba 19921126165e72', ' lipids and lipid metabolism', 'wang c cheng x sui y et al', ' a noticeable phenomenonthiol terminal peg enhances the immunogenicity ofpegylated emulsions injected intravenously orsubcutaneously into rats', ' eur j pharm biopharm2013853744e751', 'hammad m muller b', ' increasing drug solubility by meansof bile saltephosphatidylcholinebased mixed micelles', ' eurj pharm biopharm 1998463361e367', 'narain p demaria e heuman d', ' lecithin protects againstplasma membrane disruption by bile salts', ' j surg res1998782131e136', ' rtl a et al', ' microemulsion andmrestani y behbood l hamixed micelle for oral administration as new drugformulations for highly hydrophilic drugs', ' eur j pharmbiopharm 2010742219e222', 'muller k', ' structural dimorphism of bile saltlecithin mixedmicelles', ' a possible regulatory mechanism for cholesterolsolubility in bile xray structural analysis', ' biochemistry1981202404e414', 'shankland w', ' the equilibrium and structure of lecithincholate mixed micelles', ' chem phys lipids197042109e130', 'torchilin vp omelyanenko vg papisov mi et al', ' polyethylene glycol on the liposome surface on themechanism of polymercoated liposome longevity', ' biochimbiophys acta bba 19941195111e20', ' biomembranes', 'trubetskoy v torchilin v', ' polyethyleneglycol basedmicelles as carriers of therapeutic and diagnostic agents', 'stp pharma sci 19966179e86', 'trubetskoy vs torchilin vp', ' use of polyoxyethylenelipidconjugates as longcirculating carriers for delivery oftherapeutic and diagnostic agents', ' adv drug deliv rev1995162311e320', 'lukyanov an torchilin vp', ' micelles from lipid derivativesof watersoluble polymers as delivery systems for poorlysoluble drugs', ' adv drug deliv rev 20045691273e1289', 'krishnadas a rubinstein i onyukselh', ' sterically stabilizedphospholipid mixed micelles in vitro evaluation as a novelcarrier for waterinsoluble drugs', ' pharm res2003202297e302', 'ashok b arleth l hjelm rp et al', ' in vitro characterizationof pegylated phospholipid micelles for improved drugsolubilization effects of peg chain length and pcincorporation', ' j pharm sci 200493102476e2487', 'kaminskas lm mcleod vm porter h et al', ' differences incolloidal structure of pegylated nanomaterials dictate thelikelihood of accelerated blood clearance', ' j pharm sci2011100115069e5077', '102 singh d rawat m semalty a et al', 'chrysophanolephospholipid complex', ' j therm analcalorim 201311132069e2077', '103 shivanand p kinjal p', ' phytosomes technical revolution inphytomedicine', ' int j pharmtech res 201021627e631', '104 bombardelli e', ' phytosome new cosmetic delivery system', 'boll chim farm 199113011431', '105 pathan ra bhandari u', ' preparation  characterization ofembelinephospholipid complex as effective drug deliverytool', ' j incl phenom macrocycl chem 2011691e2139e147', '106 semalty a semalty m rawat bs et al', ' pharmacosomes thelipidbased new drug delivery system', ' 2009', '107 shelke ss', ' phytosomesa new herbal drug delivery system', 'int j res pharm biomed sci 2012341710e1715', '108 rao r squillante iii e kim kh', ' lipidbased cochleates apromising formulation platform for oral and parenteraldelivery of therapeutic agents', ' crit rev ther drug carriersyst 2007241', '109 zarif l graybill jr perlin d et al', ' cochleates new lipidbased drug delivery system', ' j liposome res2000104523e538', '110 syed um woo af plakogiannis f et al', ' cochleates bridgedby drug molecules', ' int j pharm 20083631118e125', '111 marone p elsmore s sandulow j et al', ' structuraldeterminants of divalent cationinducedphosphatidylserine cochleate crystallization', ' microscmicroanal 200511s021244e1245', '112 gouldfogerite s mannino rj', ' mucosal and systemicimmunization using cochleate and liposome vaccines', ' jliposome res 199662357e379', '113 delmarre d gouldfogerite s mannino r', ' formulation ofhydrophobic drugs into cochleate delivery vehicles asimplified protocol  bioral tm formulation kit', ' drug delivtechnol 2004411e10', '114 rawat m singh d saraf s et al', ' lipid carriers a versatiledelivery vehicle for proteins and peptides', ' proteins 200832', '115 sanchezmigallon mp aranda fj gomezfernandez jc', ' roleof phosphatidylserine and diacylglycerol in the fusion ofchromaffin granules with target membranes', ' arch biochembiophys 19943141205e216', '116 nerozzi d aceti f melia e et al', ' phosphatidylserine andmemory disorders in the aged', ' la clinica terapeutica19871205399e404', '', ''], 'Phytochemical Screening And Evaluation Of Analgesic And Thrombolytic Activity Of The Crude Methanoli': ['', 'medicinal plants abound with many phytochemicals that are effective in representing lots of pharmacological activities', ' the current study aimed at investigating the phytochemical and pharmacological activity of crude methanol extract of calamus rotang l', ' crme leaves', ' the analgesic activity and thrombolytic activity were examined by the acetic acidinduced writhing method while the clot lysis effect was evaluated by an invitro thrombolytic method', ' from this study it is stated that the extract 400 200 mgkg reduced abdominal writhing by 31', '06 and 44', '33 for 200 mgkg and 400 mgkg respectively while the standard showed 58', '57 of inhibition and increased the pain reaction time in mice when compared to that of the negative control group in tailimmersion test', ' the extract presented 16', '2  1', '75 of human blood clot lysis in the thrombolytic experiment', ' the presence of steroids saponins glycosides cardenolides flavonoids carbohydrates and reducing sugars might have an influence on the pharmacological activity of crme', '', 'calamus rotang l', ' leaves phytochemical antinociceptive thrombolytic tailimmersion', 'traditional medicines are very popular with a view to having an intense historical and cultural value in many developing countries 1', ' it has also gained popularity for its tremendous medicinal properties in the treatment and prevention of different types of diseases 2', ' a report published by who states that about 80 of the worlds population relies mainly on herbal medicine for their primary health care needs and most of the traditional therapy uses the plant extracts and their active constituents due to their safety and effectiveness 3 4', 'the synthetic drugs that are used in the treatment of analgesia and thrombosis have different types of adverse effects and some are costly 5', ' the plantbased drug discovery can avert this in an effective and safe manner', ' calamus rotang l', ' commonly known as bet is a common growing shrub and medicinal plant in bangladesh belonging to the family arecaceae 6', ' it is an evergreen climber and a native plant of southwest asia 6', 'this medicinal plant possesses several medicinal uses because of the presence of secondary metabolites like saponin in the stem alkaloid in the leaves and flavonoid in the root 7', ' it has shown several medicinal properties including antidiarrheal antiinflammatory antipyretic antidiabetic astringent antibilious spasmolytic woodvermifuge effects 8', ' its tender shoots are utilized as a febrifuge 9 antihelminthic by tribal people 6', ' its leaf sap is used for eye problem 6 and in the treatment of biliousness and diseases of the blood 8', ' the stem bark is used in the treatment of chronic fevers and as an antidote to snake venom 10', 'the plant extracts also possess cooling alexiteric hypotensive depurative diuretic febrifuge hyperdipsia cough bronchitis vesical calculi chronic fever and to treat skin disease 11', 'considering the traditional use of calamus rotang here we designed the study to assess the analgesic activity by an acetic acidinduced writhing method and tailimmersion method thrombolytic activity by clot lysis method and evaluate the presence of phytochemical constituents', '', 'materials analytical and laboratorygrade e', 'g', ' sigma e', ' merck or bdh reagents like mayers reagent wagners reagent fehlings solution copper sulfate sulfuric acid hydrochloric acid ferric chloride zinc dust chloroform pure naphthol lead acetate glacial acetic acid etc', ' were used for phytochemical screening', 'collection and identification of plant materials the matured plant leaves were collected from chattogram division of bangladesh', ' then it was distinguished as calamus rotang by taxonomist dr', ' shaikh bokhtear uddin professor department of botany the university of chittagong under the identification no ra203426', 'extract preparation plant leaves were washed properly and semi shed sundried for seven days', ' after drying in an oven the plant materials were ground using a mechanical grinder', ' 330 gm of dried powder of c', ' rotang leaves were soaked in 2000 ml of methanol and kept at room temperature with occasional shaking', ' after 13 days the solution was filtered through filter cloth followed by whatman no', ' 1 filter paper and the filtrate thus obtained was concentrated by using a rotary evaporator', ' the weight of extract yielded was 23', '81 gm', ' the percentage yield of the extract was calculated using the following equation12 yield of extracts  weight of extracted material  100  weight of original plant material usedexperimental animals male swiss albino mice of 2535 gm were used for an invivo test which was bought from the bangladesh council of scientific and industrial research bcsir chattogram bangladesh', ' these were housed properly and served an adequate diet with drinking water ad libitum throughout the study', 'phytochemical screening phytochemical screening of crme was performed by using standard procedures 13 14 15', ' the color intensity or the precipitate formation was used as analytical responses to these qualitative tests', 'invivo analgesic activity assayacetic acidinduced writhing method the peripheral analgesic study was conducted by using an acetic acidinduced writhing method following the previously described method 16 with slight modifications', ' of four groups of mice five mice per group each were administered 1 tween80 solution 10 mlkg negative control diclofenac sodium 10 mgkg positive control and crme 200 mgkg crme 400 mgkg respectively all by oral route 30 min prior to ip administration of 0', '7 glacial acetic acid gaa at 10 mlkg', ' after 5 min of ip administration of 0', '7 gaa the abdominal writhing of each mouse was carefully counted for 20 min', ' the percentage inhibition of writhing was calculated to investigate the degree of analgesia using the formula 17 inhibition of writhing  nc  nt  100  nchere nc  number of writhings in the negative control and nt  number of writhings in test animalstailimmersion test the analgesic test was conducted by another method tailimmersion test following a previously described method 18 with minor modifications', ' of four groups of mice five mice per group each was administered 1 tween80 solution 10 mlkg negative control crme 200 mgkg crme 400 mgkg orally and morphine sulfate 10 mgkg positive control by ip route', 'about 3 cm of the terminal point of the tail of mice were immersed in warm water by using a water bath at a temperature of 50 c', ' then the tailflick time of each mice from the water was counted for 30 min prior to and 30 60 90 and 120 min after treatment', ' the cut off period was 15 sec to avoid the tail damage', 'the percentage of the maximal possible effect mpe of crme was calculated using the following equation 19 mpe  post drug latency  pre drug latency  100  cuttoff time  pre drug latencythe percentage of time elongation te produced by crme with comparison to positive control was calculated from the following equation20te  latency extract  latency positive control  100  latency extractinvitro thrombolytic activity assay the thrombolytic study was carried out according to the method reported earlier 21', ' the test solution was prepared by mixing 100 mg of crme with 10 ml of distilled water dw and was shaken vigorously on a vortex mixer', ' after overnight it was filtered by using a 0', '22micron syringe filter', ' of twelve preweighed eppendorf tubes each containing 500 µl of blood samples were incubated at 37 c for 45 min', ' after clot formation the serum was completely removed from each eppendorf tube and the clot weight was determined clot weight weight of clot filled eppendorf  weight of empty eppendorf', ' then 100 μl of commercially available lyophilized streptokinase sk 15 00000 i', 'u', ' positive control 100μl of dw negative control and 100 μl of crme were separately added to the eppendorf tubes and again incubated at 37 c for 90 min', 'after incubation the serum was completely removed and the percentage of clot lysis was determined as followings clot lysis  wb  wc  100  wbhere wb  weight of clot before lysis wc  weight of clot after lysisstatistical analysis all data were analyzed by using statistical software statistical package for social science spss version 16', '0 ibm corporation ny', ' graphs were prepared by graph pad prism data editor for windows version 5', '03 graphpad software inc', ' san diego ca', 'resultsacetic acidinduced writhing method the peripheral analgesic effect of crme in the acetic acidinduced writhing method was presented in table 2 and fig', ' 1', 'table 2 screening of peripheral analgesic activity of calamus rotang by using the acetic acidinduced writhing methodtreatmentdoseno', ' of writhing of inhibitionnegative control10 mlkg38', '62  1', '087crme200 mgkg26', '62  1', '028a31', '06400 mgkg21', '50  1', '429a44', '33diclofenac sodium10 mgkg16', '00  0', '353a58', '57crme crude methanolic extracts of c', ' rotang leaves values were expressed as mean  sem n5', ' ap 0', '001 is statistically significant in comparison to the negative control done by one way anova followed by post hoc dunnett t test', 'fig', ' 1 screening of peripheral analgesic activity of calamus rotang by using acetic acidinduced writhing method crme crude methanolic extracts of c', ' rotang leaves values were expressed as mean  sem n5', ' a p 0', '001 is statistically significant in comparison to the negative control', 'tailimmersion test the result of the central analgesic activity of crme obtained from the tailimmersion test was demonstrated in table 3 table 4 and fig', ' 2', 'crme crude methanolic extracts of c', ' rotang leaves values were expressed as mean  sem n5', '  ap 0', '001 is statistically significant with a comparison to the negative control bp 0', '001 is statistically significant in comparison of crme 400mgkg to crme 200 mgkg done by one way anova followed by post hoc tukey test', 'table 4 screening of central analgesic activity of calamus rotang by calculating te using tailimmersion testfig', ' 2 screening of central analgesic activity calamus rotang by using tailimmersion test', ' crme crude methanolic extracts of c', ' rotang leaves values were expressed as mean  sem n5', ' ap 0', '001 is statistically significant with comparison to control bp 0', '001 is statistically significant in comparison of crme 400 mgkg to crme 200 mgkg', 'sk streptokinase crme crude methanolic extracts of c', ' rotang leaves values were expressed as mean  sem ap 0', '001 significant when compared with the corresponding value of dw and bp 0', '001 significant when compared with the corresponding value of sk done by one way anova followed by post hoc tukey test', 'invitro thrombolytic activity assay as a part of discovering natural medicine as the cardioactive drug the antithrombotic effect of crme was evaluated and the result was represented in table 5 and fig', ' 3', 'fig', ' 3 screening of thrombolytic activity of crude methanolic extracts of c', ' rotang leaves crme', ' sk streptokinase values were expressed as mean  sem ap 0', '001 significant when compared with the corresponding value of negative control and bp 0', '001 significant when compared with the corresponding value of skdiscussion plants combine different end products of metabolites and toxic substances in the form of secondary metabolites', ' these are stored and used for protection from insects herbivorous animals pathogenic organisms and source of different essential elements', ' the secondary metabolites were further exploited as antibiotics anthelminthic agents anticoagulants antitumor substances and carcinogens cardioexcitatory substances growth substances and hormones haemagglutinins and lectintype agglutinins hypotensives insecticides toxins and vitamins', ' the current study revealed the presence of steroids saponins glycosides cardiac glycosides flavornoids and phlorotannins in crme', ' many of the aforementioned compounds can be directly and synthetically modified and used in medicine', ' the acetic acid induced writhing model was applied to assess the peripheral analgesic activity of crme 22 which used ip 0', '7 of the gaa to stimulate peripheral pain receptors and caused to release free arachidonic acid aa from the tissue phospholipid 23', ' it resulted in the abdominal writhing of a mouse', 'the capability of the suppression of this writhing reflex was used as the indicator of the peripheral analgesic activity of crme', ' crme 200 mgkg 31', '06 and 400 mgkg 44', '33 showed a significant p 0', '001 increase in percentage  of inhibition of writhing in comparison to negative control in a dosedependent manner', ' it was clearly evident that crme exerted a moderate peripheral analgesic effect in comparison to highly potent nsaid diclofenac sodium', ' previous researches reported that the flavonoids inhibited prostaglandin synthesis and contributed to the analgesic activity 24', ' the presence of this phytochemical in crme might attribute to its peripheral analgesic activity', ' the tail immersion model was employed to assess the potential narcotic analgesic activity of crme by using thermal stimuli 23', 'in this method the heat stimulated nonmyelinated c fibers of the mouses tail caused the release of excessive substance p 20', ' the pain receptors were activated when the thermal stimulus reached beyond the threshold of pain receptors and they were sensitized by the sensory nerves 25', ' in addition the thermal stimulus was sensitive to opioid µreceptor 26', ' it was noticed that crme 200 mgkg crme 400 mgkg and morphine sulfate showed more post drug latency the mpe and te than that of the negative control at a different time interval which indicated the possible significant p0', '001 central analgesic effect of crme in a dosedependent manner', 'crme was observed to manifest moderate central analgesic activity in comparison to morphine sulfate whose effect was reduced and increased gradually with the time span at 200 mgkg and 400 mgkg respectively', ' commercially available thrombolytic drugs like sk activates other plasminogen to plasmin by complexing with circulatory plasminogen which in turn dissolves fibrinogen and fibrin the insoluble matrix of the clot that results in lysis of blood clot 27', 'in the current study of evaluation of the thrombolytic activity of crme with the comparison of the percentage of clot lysis of positive control sk to the negative control dw it was evident that the dissolution of the clot was negligible upon addition of dw', ' significant p0', '001 mild thrombolytic activity was exhibited by crme 16', '2  1', '75 when compared to sk 63', '3  2', '81 and dw 4', '08  0', '56', ' several types of researches have revealed that alkaloid 21 flavonoids 28 and cardiac glycoside 29 were effective against thrombosis and coronary artery diseases the presence of which might have contributed to the slight thrombolytic activity of crme', '', 'natural product development for the treatment of different diseases is of utmost importance', ' crme possessed moderate central and peripheral analgesic anxiolytic activity in a dosedependent manner', ' it also exhibited mild thrombolytic and anthelmintic effects at higher concentrations', ' further researches regarding the isolation of its active compounds must be considered to evaluate its activities in various medical treatments', '', 'the authors would like to thank dr', ' shaikh bokhtear uddin professor department of botany the university of chittagong for the identification of the plant', ' the authors would also like to thank all the teachers and staff of the department of pharmacy the university of chittagong for their support', 'conflicts of interest the authors declare no conflict of interest', '', 'krishnaraju av rao tv sundararaju d vanisree m tsay hs and subbaraju gv assessment of bioactivity of indian medicinal plants using brine shrimp artemia salina lethality assay', ' international journal of applied sciences and engineering 2005 32 12534', 'proma nm naima j islam mr papel ja rahman mm and hossain mk phytochemical constituents and antidiabetic properties of syzygium cumini seed', ' international journal of pharmaceutical sciences and research 2018 95 180614', 'mishra p kumar a nagireddy a mani dn shukla ak tiwari r and sundaresan v dna barcoding an efficient tool to overcome authentication challenges in the herbal market', ' plant biotech j 2016 141 821', 'sen s and chakraborty r revival modernization and integration of indian traditional herbal medicine in clinical practice importance challenges and future', ' journal of traditional and complementary medicine 2017 72 23444', 'naima j islam mr proma nm afrin sr hossain mr and hossain mk phytochemical screening and antinociceptive activity of mimosa diplotricha international journal of pharmaceutical sciences and research 2019 108 367984', 'basumatary s ahmed m and deka s some medicinal plant leaves used by boro tribal people of goalpara district assam', ' natural product radiance 2004 32', 'ripa fa dash pr and faruk o cns depressant analgesic and antiinflammatory activities of methanolic seed extract of calamus rotang fruits in rat', ' journal of pharmacognosy and phytochemistry 2015 3 12125', 'roy s kumari d chakraborty m and haldar pk anti proliferative activity of calamus rotang as a spotlight on ehrlichs ascites carcinoma treated peritoneal as well as solid tumor model', ' international journal of pharmacy and pharmaceutical sciences 2018 10 8590', 'rethy p singh b kagyung r and gajurel p ethnobotanical studies of dehangdebang biosphere reserve of arunachal pradesh with special reference to memba tribe 2010', 'de sarker d saha mr and saha s perspective of dietetic and antioxidant medicinal plants notion press 2015', 'ganesan k and xu b ethnobotanical studies on folkloric medicinal plants in nainamalai namakkal district tamil nadu india', ' trends in phytochem res 2017 13 15368', 'ezeja m omeh y ezeigbo i and ekechukwu a evaluation of the analgesic activity of the methanolic stem bark extract of dialium guineense wild', ' annals of medical and health science research 2011 11 5562', 'bolanle ao funmilola as and adedayo a proximate analysis mineral contents amino acid composition antinutrients and phytochemical screening of brachystegia eurycoma harms and pipper guineense schum and thonn', ' american journal of food and nutrition 2014 2 117', 'ugbaja cc fawibe oo oyelakin as fadimu io ajiboye aa and agboola da comparative phytochemical and nutritional composition of trichosanthes cucumerina l', ' and some solanum lycopersicum l', ' cultivars in nigeria', ' american journal of plant sciences 2017 82 29709', 'evans w trease and evans 15thedn', ' sanders co', ' ltd', ' singapore 2002', 'suresha rn amoghimath s vaibhavi ps shruthi sl jayanthi mk and kalabharathi hl evaluation of analgesic activity of perindopril in albino mice', ' journal of advanced pharmaceutical technology  research 2014 53 12933', 'anafi s yaro a abbasyakubu m and yakubu a evaluation of analgesic and antiinflammatory activities of methanol leaf extract of croton lobatus euphorbiaceae in rodents', ' trop journal of nat prod res 2017 16 25558', 'karim n khan i ahmad n umar mn and gavande n antidepressant anticonvulsant and antinociceptive effects of 3methoxy6methylflavone and 3hydroxy6methylflavone may involve gabaergic mechanisms', ' pharmacological reports 2017 695 101420', 'boakyegyasi e henneh it abotsi wk ameyaw eo and woode e hydroethanolic leaf extract of ziziphus abyssinica hochst ex a', ' rich rhamnaceae exhibits antinociceptive effects in murine models', ' bmc complementary and alternative med 2017 171 231', 'kumawat rk kumar s and sharma s evaluation of analgesic activity of various extracts of sida tiagii acta pol pharm 2012 69 110309', 'hussain ms hossain ms amin mt and millat ms in vitro thrombolytic potentials of methanolic extract of vigna unguiculata linn seed', ' journal of pharmacognosy and phytochemistry 2016 53 12931', 'kaushik d kumar a kaushik p and rana a analgesic and antiinflammatory activity of pinus roxburghii advances in pharmacological sciences 2012 245431', 'islam mr naima j proma nm hussain ms uddin sn and hossain mk invivo and invitro evaluation of pharmacological activities of ardisia solanacea leaf extract', ' clinical phytoscience 2019 51 32', 'mali a bandawane d and hivrale m evaluation of antiinflammatory and analgesic activity of methanol extract of cassia auriculata pharmacol 2013 42 11725', 'burma ne leducpessah h fan cy and trang t animal models of chronic pain advances and challenges for clinical translation', ' journal of neuroscience research 2017 956 124256', 'montillagarcía á perazzoli g tejada ma gonzálezcano r sánchezfernández c cobos ej and baeyens jm modalityspecific peripheral antinociceptive effects of μopioid agonists on heat and mechanical stimuli contribution of sigma1 receptors', ' neuropharmacology 2018 135 32842', 'maheshwari n kantipudi s maheshwari a arora k kwatra n and sahni g aminoterminal fusion of epidermal growth factor 4 5 6 domains of human thrombomodulin on streptokinase confers antireocclusion characteristics along with plasminmediated clot specificity', ' plos one 2016 113 e0150315', 'khatun a rahman m uddin kn ahsan k shimu sn kobra k shimu sa haque w rahman t jessy th and akhter f preliminary study on thrombolytic property of thirty six different extracts of eight bangladeshi medicinal plants with folkloric relevance', ' oriental pharmacy and experimental medicine 2016 164 3119', 'mahmud s akhter s and rahman m antithrombotic effects of five organic extracts of bangladeshi plants in vitro and mechanisms in insilico evidencebased complem and altern med 2015', '', ''], 'Real Time Calorimetric Characterisation Of Clay Drug Complex Dispersions And Particles': ['', 'isothermal titration calorimetry itc along with attenuated total reflectance fourier transform infrared spectroscopy atrftir scanning electron microscopy with energy dispersive xray spectroscopy semedx andhighperformance liquid chromatography hplc were employed to investigate the process of adsorption ofpropranolol hydrochloride ppn onto magnesium aluminium silicate mas and to characterise the masppnparticles formed upon complexation', ' the composition of mas was confirmed by infrared ir spectroscopy and acalcimeter', ' the calorimetric results confirmed the binding between ppn and mas at various phs and temperatures', ' the overall change in enthalpy was found to be exothermic with a comparatively small entropiccontribution to the total change in gibbs free energy', ' these findings suggest that the binding process wasenthalpically driven and entropically unfavourable lower affinity suggesting hydrogen bonding and electrostatic interactions dominating the interaction', ' the variation of ph and temperature did not have a great impacton the thermodynamics of the binding process as observed from the similarity in enthalpy δh entropy δs orgibbs free energy δg', ' a slight reduction in the binding affinity ka with varing ph and temperature washowever observed', ' semedx studies showed the occurrence of changes in the microstructural properties of masfollowing complexation which may explain the potential of masppn complexes for controlled drug releasepromoting pharmaceutical innovation', '', 'magnesium aluminium silicatepropranolol hydrochlorideisothermal titration calorimetrycomplexation', 'sustainedrelease drug formulation is of high importance as itachieves optimal therapeutic efficacy in chronic conditions wheretreatment must be administered at constant levels over a period of timeand provides a reduced frequency of side effects aulton 2007', ' inrecent years excipients such as clay minerals have often been used ascarriers of active ingredients to retard or modulate drug releasetrikeriotis and ghanotakis 2007 park et al', ' 2008 joshi et al', ' 2009meng et al', ' 2009 pongjanyakul et al', ' 2009 rojtanatanya andpongjanyakul 2010', ' their physicochemical properties make themsuitable to be used in the formulation of pharmaceutical dosage formsas they can adsorb the active ingredient onto their structure and formcomplex dispersions and particles carretero and pozo 2009pongjanyakul et al', ' 2009 rojtanatanya and pongjanyakul 2010', 'kanjanakawinkul et al', ' 2013 rongthong et al', ' 2013', ' these have beenshown to modify the release of drugs upon administration which wouldbe desirable for drugs having a short half', '', '', '', ''], 'Recent Advances And Perspectives Of Nucleic Acid': ['journal of pharmaceutical analysis 10 2020 97e101contents lists available at sciencedirectjournal of pharmaceutical analysisjournal homepage www', 'elsevier', 'comlocatejpareview paperrecent advances and perspectives of nucleic acid detection forcoronavirusminzhe shen ying zhou jiawei ye abdu ahmed abdullah almaskri yu kang su zengsheng caiinstitute of drug metabolism and pharmaceutical analysis zhejiang province key laboratory of anticancer drug research college of pharmaceuticalsciences zhejiang university hangzhou zhejiang 310058 chinaa r t i c l e i n f o', 'article historyreceived 23 february 2020received in revised form27 february 2020accepted 27 february 2020available online 1 march 2020the recent pneumonia outbreak caused by a novel coronavirus sarscov2 is posing a great threat toglobal public health', ' therefore rapid and accurate identiﬁcation of pathogenic viruses plays a vital role inselecting appropriate treatments saving peoples lives and preventing epidemics', ' it is important toestablish a quick standard diagnostic test for the detection of the infectious disease covid19 toprevent subsequent secondary spread', ' polymerase chain reaction pcr is regarded as a gold standardtest for the molecular diagnosis of viral and bacterial infections with high sensitivity and speciﬁcity', 'isothermal nucleic acid ampliﬁcation is considered to be a highly promising candidate method due to itsfundamental advantage in quick procedure time at constant temperature without thermocycler operation', ' a variety of improved or new approaches also have been developed', ' this review summarizes thecurrently available detection methods for coronavirus nucleic acid', ' it is anticipated that this will assistresearchers and clinicians in developing better techniques for timely and effective detection of coronavirus infection', ' 2020 xian jiaotong university', ' production and hosting by elsevier b', 'v', ' this is an open access articleunder the cc byncnd license httpcreativecommons', 'orglicensesbyncnd4', '0', '', 'coronavirusnucleic acid detectionpcrbased methodsisothermal nucleic acid ampliﬁcationbasedmethodsmicroarraybased methods', 'the ﬁght against infectious diseases caused by viruses remains achallenging and endless task despite the tremendous efforts andsigniﬁcant advances in public healthcare', ' infectious diseases pose asigniﬁcant risk to human health and have led to approximately onefourth of deaths worldwide 12', ' coronaviruses belong to the familyof coronaviridae and may cause respiratory and neurological diseases 3', ' until now six human coronaviruses hcovs have beenidentiﬁed namely hcov229e hcovhku1 hcovoc43 hcovnl63 severe acute respiratory syndrome coronavirus sarscovand middle east respiratory syndrome coronavirus merscov 4', 'in particular sarscov and merscov once caused pandemic 5', 'recently the emergence of novel coronavirus sarscov2 hasbeen challenging the global public health community to confront anovel infectious disease coronavirus disease 2019 covid19', ' as of22 february 2020 there were 77816 conﬁrmed cases of covid19peer review under responsibility of xian jiaotong university', ' corresponding authors', 'email addresses zengsuzju', 'edu', 'cn s', ' zeng caishengzju', 'edu', 'cn s', ' cai', 'and 2012 deaths httpswww', 'worldometers', 'infocoronavirus', ' inthis epidemic the detections of sarscov2 rna were shown to beuseful for the early diagnosis of covid19 which would be beneﬁcial to controling the sources of infection and help patients toprevent the illness progression', ' the rapid and accurate detection ofcoronavirus is therefore becoming increasingly important', 'with the advance in molecular biology technology nucleic aciddetection methods have developed rapidly and become a revolutionary technology for virus detection', ' especially the methodbased on polymerase chain reaction pcr is characterized by rapiddetection high sensitivity and speciﬁcity which has been regardedas the gold standard for virus detection', ' novel pcrbasedmethods also have been reported to enhance both the speciﬁcityand sensitivity of the assay', ' besides several molecular tests whichemploy nonpcrbased methods such as isothermal nucleic acidampliﬁcation loop mediated isothermal ampliﬁcation lamp andnucleic acid sequencebased ampliﬁcation were developed for thedetection of coronavirus rna', ' in this work we reviewed variousapproaches currently available for detection of coronavirus', ' it isanticipated that this will assist researchers to develop rapid andaccurate detection techniques', 'httpsdoi', 'org10', '1016j', 'jpha', '2020', '02', '01020951779 2020 xian jiaotong university', ' production and hosting by elsevier b', 'v', ' this is an open access article under the cc byncnd license httpcreativecommons', 'orglicensesbyncnd4', '0', '98m', ' shen et al', '  journal of pharmaceutical analysis 10 2020 97e1012', ' pcrbased methodspcr is an enzymatic method to produce numerous copies of a geneby separating the two strands of the dna containing the genesegment marking its location with a primer and using a dna polymerase to assemble a copy alongside each segment and continuouslycopy the copies', ' it is widely used to amplify minute quantities ofbiologic materials so as to provide adequate specimens for laboratorystudy', ' owing to its large range of applications high sensitivity andhigh sequence speciﬁcity the pcrbased method has become aroutine and reliable technique for detecting coronaviruses 67', 'generally coronavirus rna is transferred into cdna by reversetranscription', ' afterwards the pcr is performed and followed by thedetection of pcr product through speciﬁc detection methods or instruments', ' among these gel visualization and sequencing after pcrare the conventional methods for the detection of coronaviruses 89', 'however due to its timeconsuming process and high cost thesemethods are not commonly used in clinical samples', 'realtime reverse transcriptasepcr rtpcr detection iscurrently favored for the detection of coronavirus because of its advantages as a speciﬁc and simple quantitative assay', ' moreover realtime rtpcr is more sensitive than the conventional rtpcr assaywhich helps much for the diagnosis in early infection 1011', ' therefore the realtime rtpcr assay still is a predominant method to beapplied for the detection of all kinds of coronaviruses 1213including sarscov2 14', 'even so massive efforts are invested to improve the realtimertpcr assay', ' since the rtpcr methods are prone to contamination and require timeconsuming sample handling and postpcranalysis van elden et al', ' 15 described a taqmanbased realtimertpcr that can easily be implemented in the routine diagnosticsetting for the detection of hcov', ' moreover to further improve thesensitivity yip et al', ' 16 designed a realtime quantitative rtpcrassay for sarscov with the use of 2 taqman probes instead of 1probe', ' this simple modiﬁcation using dual taqman probes forquantiﬁcation has wide applications in areas in which ultrasensitivity is critically required with the sarscov detection limitof 1 copy rna per reaction', 'in clinical detection the lack of safe and stable external positivecontrols epc could become a serious problem in the diagnosis ofcoronavirus and plenty of attention has been focused to address thisproblem', ' however such problems could be well avoided in realtimertpcr assays where epc is an important component', ' yu et al', ' 17developed a realtime rtpcr assay in which the armored rna wasused as epc to detect the sarscov with a detection limit of 10copiesml', ' meanwhile the rapidly mutating nature of coronaviruseshighlights the need for accurate detection of genetically diversecoronaviruses', ' therefore to improve the ability to detect coronavirusprecisely and reduce the risk of eliciting falsenegative results causedby genome sequence variations researchers have establishedmultiplex realtime rtpcr methods with favorable sensitivity formultitarget detection of coronavirus', ' hadjinicolaou et al', ' 18developed a realtime rtpcr assay using mismatchtolerant molecular beacons to distinguish between pathogenic and nonpathogenic strains', ' the assay incorporated four beacons targetingfour genes in addition to an internal positive control', ' it was validatedusing clinical samples which exhibited target detection ability andspeciﬁcity with detection limit of 5 copies per reaction', '3', ' isothermal nucleic acid ampliﬁcationbased methods3', '1', ' regular lampbased methodsthe lamp is a novel isothermal nucleic acid ampliﬁcationmethod with high efﬁciency', ' it is commonly used for theampliﬁcation of dnas and rnas which exhibits great sensitivityand high speciﬁcity as a result of its exponential ampliﬁcationfeature and 6 different target sequences identiﬁed by 4 differentprimers simultaneously respectively 19', ' the lamp assay is rapidand does not require expensive reagents or instruments', ' thereforethe application of lamp test might help to reduce the cost fordetection of coronavirus 20', ' herein a number of lampbasedcoronavirus detection methods have been developed and appliedin clinical diagnosis', 'gel electrophoresis is commonly used to analyze the ampliﬁedproducts for an endpoint detection', ' poon et al', ' 21 reported a simplelamp assay for sars diagnosis and demonstrated the feasibility ofusing this technology for detection of sarscov', ' the orf1b region ofsarscov was chosen for sars diagnosis and ampliﬁed by lampreaction in the presence of 6 primers then the ampliﬁed productswere analyzed by gel electrophoresis', ' the detection rates and thesensitivity for sarscov in the lamp assay are similar to those ofconventional pcrbased methods', ' pyrc et al', ' 22 successfully appliedlamp to the detection of hcovnl63 which was conducted byagarose gel electrophoresis with favorable sensitivity and speciﬁcityin cell cultures and clinical specimens', ' notably the detection limitwas found to be 1 copy of rna template per reaction', 'ampliﬁcation can be detected as the precipitation of magnesiumpyrophosphate or ﬂuorescence dye', ' this enables the methods to becarried out in real time by monitoring the turbidity of the pyrophosphate or ﬂuorescence which has effectively overcome thelimitations of the endpoint detection 23', ' a useful rtlamp assayfor the diagnosis and epidemiologic surveillance of human merscov was developed in this way by shirato et al', ' 24 which iscapable of detecting as few as 3', '4 copies of merscov rna and ishighly speciﬁc with no crossreaction with other respiratory viruses', ' thai et al', ' 25 developed a onestep singletube acceleratedrealtime quantitative rtlamp assay monitored by realtimemeasurement of turbidity in a photometer for the early and rapiddiagnosis of sarscov', ' in clinical samples the assay was found tobe 100fold more sensitive than conventional rtpcr with adetection limit of 0', '01 plaque forming units pfu', '3', '2', ' sequencespeciﬁc lampbased methodshowever if the methods rely on nonspeciﬁc signal transductionschemes such as the ﬂuorescence dyes intercalation into anydoublestranded dna amplicons or solution turbidity due to therelease of pyrophosphates during polymerization the possibility ofunexpected signals derived from primer dimer or nonprimer reactions cannot be excluded 26', ' a sequencespeciﬁc and robustmethod for monitoring lamp and other isothermal ampliﬁcationreactions that can readily separate true signal from nonspeciﬁcnoise would address this problem', ' shirato et al', ' 27 improved thertlamp assay by using a quenching probe qprobe to monitorsignal which has the same performance as the standard realtimertpcr assay in the detection of merscov', ' additionally huanget al', ' 4 established a nucleic acid visualization technique thatcombines rtlamp and a vertical ﬂow visualization strip rtlampvf to detect merscov', ' as illustrated in fig', ' 1a two loopprimers lf and lb involved in isothermal ampliﬁcation are labeledwith ﬂuorescein isothiocyanate fitc and biotin respectively', ' afterampliﬁcation the amplicons labeled with biotin can bind tocolloidal gold particles conjugated with streptavidin to form acomplex which is subsequently captured by an antifitc antibodycoated on the text line of the strip fig', ' 1b thus presenting acolored line that is visible to the naked eye', ' in this instance merscov rna can be detected with a detection limit of 10 copiesml', 'scientists from ellingtons group did plenty of work to bothimprove the speciﬁcity of lamp detection and make readout3', '3', ' rolling circle ampliﬁcationbased methodsthe rolling circle ampliﬁcation rca has attracted considerableattention in nucleic acid determination 3536', ' in isothermalconditions rca is capable of a 109fold signal ampliﬁcation of eachcircle within 90 min', ' an efﬁcient assay for the detection of sarscov by rca was set up in both liquid and solid phases 37 andpresented preliminary results on a small number of clinical respiratory specimens', ' the main advantage of rca is that it can beperformed under isothermal conditions with minimal reagents andavoid the generation of falsepositive results which is frequentlyencountered in pcrbased assays', '4', ' microarraybased methodssimpler and more reliable', ' they replaced the intercalating dyetypically used for monitoring in realtime ﬂuorescence with atoeholdmediated strand exchange reaction termed onestepstrand displacement osd and applied it for realtime sequencespeciﬁc veriﬁcation of lamp amplicons 28e30', ' the resulting assays could detect 0', '02 to 0', '2 pfu 5e50 pfuml of merscov ininfected cell culture supernatants within 30e50 min and did notcrossreact with common human respiratory pathogens 31', ' otherstrand exchange signal transductions were developed to makelamp reaction userfriendly', ' as shown in fig', ' 2 by combininglamp with a thermostable invertase du et al', ' can directly transduce mers coronavirus templates into glucose signals which canbe easily read by a commercial glucometer with a sensitivity as lowas 20e100 copiesml equating to attomolar or low zeptomole32', ' the human chorionic gonadotropin hcg was also used asthe signal as its analyte was already sensitively detected by commercial pregnancy test kits', ' the hcg was sitespeciﬁcally conjugated to a dna oligonucleotide thereby allowing signaltransduction via strand exchange into both capture signaloff andrelease signalon of hcg in the lamp based virus assay 33', ' theincorporation of an engineered hcg reporter protein led to lamptohcg signal transduction on lowcost commercially availablepregnancy test strips', ' this assay reliably detected as few as 20copies of virus templates in both human serum and saliva', 'meanwhile lamp shows optimal performance at around 65  cwhich always limits its applications', ' cai et al', ' 34 developed aversion of lamp that used phosphorothioated primers pslampto enable more efﬁcient hairpin formation and extension at thetermini of growing concatamers which therefore worked at muchlower temperatures', ' the sensitivity and selectivity for amplicondetection with pslamp at 40  c were comparable with a regularlamp reaction at 65  c', 'the microarray is a detection method with rapid and highthroughput', ' for this method the coronavirus rna will ﬁrst producecdna labeled with speciﬁc probes through reverse transcription', 'then these labeled cdnas will be loaded into each well and hybridize with solidphase oligonucleotides ﬁxed on the microarrayfollowed by a series of washing steps to remove free dnas', ' finallythe coronavirus rna can be detected by the detection of speciﬁcprobes', ' due to its superiority the microarray assay has been widelyused in the detection of coronavirus 38', 'shi et al', ' 39 designed a 60mer oligonucleotide microarray according to the sequence of tor2 and successfully applied it to thedetection of sars coronavirus in clinical samples', ' howeverconsidering the rapid mutation of sarscov guo et al', ' 40developed a microarray to detect 24 single nucleotide polymorphism snp mutations among the spike s gene of sarscovwith 100 accuracy in sample detection', ' since coronavirus maylead to a sudden outbreak it is of great signiﬁcance that diagnosticassays are able to detect a wide range of coronaviruses and are bedeployable at or near the point of care poc', ' therefore luna et al', '41 designed a nonﬂuorescent lowcost lowdensity oligonucleotide array for detecting the whole coronavirus genus with asensitivity equal to that of individual realtime rtpcr and hardicket al', ' 42 evaluated a novel portable and nearpoc diagnosticplatform based on the microarray chip the mobile analysis platform map which has a good performance in identifying virus andacceptable detection limit', '5', ' newly developed methodsthe rnatargeting crispr associated enzyme cas13 hasrecently been adapted for rapid and portable sensing of nucleicacids 4344', ' zhangs group demonstrated that cas13 can be programmed to target and destroy the genomes of diverse mammaliansingle stranded rna viruses fig', ' 3 45', ' they developed a platformtermed sherlock speciﬁc highsensitivity enzymatic reporterunlocking that combined isothermal preampliﬁcation with cas13to detect single molecules of rna or dna 46', ' it can detect dengueor zika virus singlestranded rna as well as mutations in patientliquid biopsy samples', ' their lately protocol for covid19 entitleda protocol for detection of covid19 using crispr diagnostics hasbeen reported on website httpsbroad', 'iosherlockprotocolwhich may provide some reference points for researchers interested in further advancing this diagnostics system highlighting itspotential as a multiplexable portable rapid and quantitativedetection platform of nucleic acids', '6', ' summary and prospectcurrently the diagnosis of covid19 mainly relies on thedetection of the coronavirus rna', ' it is of great importance to selectequipment and educated analysts which is only possibly accomplished by a wellestablished laboratory', ' lamp is an ultrasensitivenucleic acid ampliﬁcation method that can often detect smallnumbers of dna or rna templates within roughly an hour but therequirement for high temperatures still limits its applicability', ' asfor the microarray the high cost inevitably limits its furtherapplication in the detection of coronaviruses', ' therefore it is stillnecessary to develop more effective and practical methods toovercome the shortcomings of the existing methods in the future', 'to date considerable efforts have been made to improve thedetection of coronavirus and a variety of improved or new approaches have been developed', ' in practical applications severalmethods are usually combined to avoid the drawbacks of usingsingle method as much as possible', ' in short with the rapiddevelopment of new technologies and methods we believe thatthere will be more excellent and efﬁcient detection methodsdeveloped in the future which would provide scientistsclinicianswith more choices', ' at the same time only by balancing the advantages and disadvantages of various detection assays accordingto speciﬁc purposes can we obtain the most economical andoptimal option', 'conﬂicts of interestfig', ' 3', ' scheme for detection of rna viruses using cas13', ' the ﬁgure was reproducedwith permission from ref', ' 45', 'the authors declare that there are no conﬂicts of interest', 'acknowledgmentsappropriate detection methods', ' however each of the methodsdescribed above has its own unique advantages and inevitabledisadvantages', ' pcr is widely used for virus identiﬁcation with highsensitivity and speciﬁcity but its analysis requires variouswe acknowledge ﬁnancial support from the national naturalscience foundation of china grant 81973281 the fundamentalresearch funds for the central universities 2019fza7017 andleading talent of ten thousand plan national highlevel talentsspecial support plan', '', '', '', '', '1 d', 'm', ' morens a', 's', ' fauci emerging infectious diseases threats to humanhealth and global stability plos pathog', ' 9 2013 e1003467', '2 h', ' kim m', ' park j', ' hwang et al', ' development of labelfree colorimetric assayfor merscov using gold nanoparticles acs sens', ' 4 2019 1306e1312', '3 n', ' zhang l', ' wang x', ' deng et al', ' recent advances in the detection of respiratory virus infection in humans j', ' med', ' virol', ' 92 2020 408e417', '4 p', ' huang h', ' wang z', ' cao et al', ' a rapid and speciﬁc assay for the detection ofmerscov front', ' microbiol', ' 9 2018 1101', '5 s', 'b', ' jiang s', ' xia t', 'l', ' ying et al', ' a novel coronavirus 2019ncov causingpneumoniaassociated respiratory syndrome cell', ' mol', ' immunol', ' 2020httpsdoi', 'org10', '1038s41423410204037241424', '6 a', ' balboni l', ' gallina a', ' palladini et al', ' a realtime pcr assay for bat sarslikecoronavirus detection and its application to italian greater horseshoe batfaecal sample surveys sci', ' world j', ' 2012 989514', '7 c', ' uhlenhaut j', 'i', ' cohen s', ' pavletic et al', ' use of a novel virus detection assayto identify coronavirus hku1 in the lungs of a hematopoietic stem celltransplant recipient with fatal pneumonia transpl', ' infect', ' dis', ' 14 201279e85', '8 d', ' adachi g', ' johnson r', ' draker et al', ' comprehensive detection and identiﬁcation of human coronaviruses including the sarsassociated coronaviruswith a single rtpcr assay j', ' virol', ' methods 122 2004 29e36', '9 t', 'y', ' setianingsih a', ' wiyatno t', 's', ' hartono et al', ' detection of multiple viralsequences in the respiratory tract samples of suspected middle east respiratory syndrome coronavirus patients in jakarta indonesia 20152016 int', ' j', 'infect', ' dis', ' 86 2019 102e107', '10 z', 'z', ' wan y', 'n', ' zhang z', 'x', ' he et al', ' a melting curvebased multiplex rtqpcrassay for simultaneous detection of four human coronaviruses int', ' j', ' mol', ' sci', '17 2016 1880', '11 j', 'y', ' noh s', 'w', ' yoon d', 'j', ' kim et al', ' simultaneous detection of severe acuterespiratory syndrome middle east respiratory syndrome and related batcoronaviruses by realtime reverse transcription pcr arch', ' virol', ' 162 20171617e1623', '12 v', 'm', ' corman i', ' eckerle t', ' bleicker et al', ' detection of a novel human coronavirus by realtime reversetranscription polymerase chain reaction eurosurveill', ' 17 2012 3e8', '13 x', 'y', ' lu b', ' whitaker s', 'k', 'k', ' sakthivel et al', ' realtime reverse transcriptionpcr assay panel for middle east respiratory syndrome coronavirus j', ' clin', 'microbiol', ' 52 2014 67e75', '14 v', 'm', ' corman o', ' landt m', ' kaiser et al', ' detection of 2019 novel coronavirus2019ncov by realtime rtpcr euro surveill', ' 25 2020 23e30', '15 l', 'j', 'r', ' van elden a', 'm', ' van loon f', ' van alphen et al', ' frequent detection ofhuman coronaviruses in clinical specimens from patients with respiratorytract infection by use of a novel realtime reversetranscriptase polymerasechain reaction j', ' infect', ' dis', ' 189 2004 652e657', '16 s', 'p', ' yip s', 's', 't', ' to p', 'h', 'm', ' leung et al', ' use of dual taqman probes to increasethe sensitivity of 1step quantitative reverse transcriptionpcr application tothe detection of sars coronavirus clin', ' chem', ' 51 2005 1885e1888', '17 x', 'f', ' yu j', 'c', ' pan r', ' ye et al', ' preparation of armored rna as a control formultiplex realtime reverse transcriptionpcr detection of inﬂuenza virus andsevere acute respiratory syndrome coronavirus j', ' clin', ' microbiol', ' 46 2008837e841', '18 a', 'v', ' hadjinicolaou g', 'a', ' farcas v', 'l', ' demetriou et al', ' development of amolecularbeaconbased multiallelic realtime rtpcr assay for the detection of human coronavirus causing severe acute respiratory syndrome sarscov a general methodology for detecting rapidly mutating viruses arch', 'virol', ' 156 2011 671e680', '19 t', ' notomi h', ' okayama h', ' masubuchi et al', ' loopmediated isothermalampliﬁcation of dna nucleic acids res', ' 28 2000 e63', '20 m', ' enosawa s', ' kageyama k', ' sawai et al', ' use of loopmediated isothermalampliﬁcation of the is900 sequence for rapid detection of cultured mycobacterium avium subsp', ' paratuberculosis j', ' clin', ' microbiol', ' 41 20034359e4365', '21 l', 'l', 'm', ' poon c', 's', 'w', ' leung m', ' tashiro et al', ' rapid detection of the severeacute respiratory syndrome sars coronavirus by a loopmediatedisothermal ampliﬁcation assay clin', ' chem', ' 50 2004 1050e1052', '22 k', ' pyrc a', ' milewska j', ' potempa development of loopmediated isothermalampliﬁcation assay for detection of human coronavirusnl63 j', ' virol', 'methods 175 2011 133e136', '23 y', ' mori k', ' nagamine n', ' tomita et al', ' detection of loopmediated isothermalampliﬁcation reaction by turbidity derived from magnesium pyrophosphate101formation biochem', ' biophys', ' res', ' commun', ' 289 2001 150e154', '24 k', ' shirato t', ' yano s', ' senba et al', ' detection of middle east respiratory syndrome coronavirus using reverse transcription loopmediated isothermalampliﬁcation rtlamp virol', ' j', ' 11 2014 139', '25 h', 't', 'c', ' thai m', 'q', ' le c', 'd', ' vuong et al', ' development and evaluation of a novelloopmediated isothermal ampliﬁcation method for rapid detection of severeacute respiratory syndrome coronavirus j', ' clin', ' microbiol', ' 42 20041956e1961', '26 z', 'k', ' njiru loopmediated isothermal ampliﬁcation technology towards pointof care diagnostics plos neglect', ' trop', ' dis', ' 6 2012 e1572', '27 k', ' shirato s', ' semba s', 'a', ' elkafrawy et al', ' development of ﬂuorescentreverse transcription loopmediated isothermal ampliﬁcation rtlamp using quenching probes for the detection of the middle east respiratory syndrome coronavirus j', ' virol', ' methods 258 2018 41e48', '28 b', 'l', ' li x', ' chen a', 'd', ' ellington adapting enzymefree dna circuits to thedetection of loopmediated isothermal ampliﬁcation reactions anal', ' chem', ' 842012 8371e8377', '29 y', 's', ' jiang s', ' bhadra b', 'l', ' li et al', ' robust strand exchange reactions for thesequencespeciﬁc realtime detection of nucleic acid amplicons anal', ' chem', '87 2015 3314e3320', '30 y', 's', ' jiang a', ' stacy m', ' whiteley et al', ' amplicon competition enables endpoint quantitation of nucleic acids following isothermal ampliﬁcationchembiochem 18 2017 1692e1695', '31 s', ' bhadra y', 's', ' jiang m', 'r', ' kumar et al', ' realtime sequencevalidated loopmediated isothermal ampliﬁcation assays for detection of middle east respiratory syndrome coronavirus merscov plos one 10 2015 e0123126', '32 y', ' du r', 'a', ' hughes s', ' bhadra et al', ' a sweet spot for molecular diagnosticscoupling isothermal ampliﬁcation and strand exchange circuits to glucometers sci', ' rep', ' 5 2015 11039', '33 y', ' du a', ' pothukuchy j', 'd', ' gollihar et al', ' coupling sensitive nucleic acidampliﬁcation with commercial pregnancy test strips angew', ' chem', ' int', ' ed', ' 562017 992e996', '34 s', ' cai c', ' jung s', ' bhadra et al', ' phosphorothioated primers lead to loopmediated isothermal ampliﬁcation at low temperatures anal', ' chem', ' 902018 8290e8294', '35 s', 'c', ' chapin p', 's', ' doyle ultrasensitive multiplexed microrna quantiﬁcation onencoded gel microparticles using rolling circle ampliﬁcation anal', ' chem', ' 832011 7179e7185', '36 m', 'c', ' xu j', 'w', ' ye d', ' yang et al', ' ultrasensitive detection of mirna via onesteprolling circlequantitative pcr rcqpcr anal', ' chim', ' acta 1077 2019208e215', '37 w', 'k', ' wang c', 't', ' fang h', 'l', ' chen et al', ' detection of severe acute respiratorysyndrome coronavirus rna in plasma during the course of infection j', ' clin', 'microbiol', ' 43 2005 962e965', '38 q', ' chen j', ' li z', 'r', ' deng et al', ' comprehensive detection and identiﬁcation ofseven animal coronaviruses and human respiratory coronavirus 229e with amicroarray hybridization assay intervirology 53 2010 95e104', '39 r', ' shi w', 'l', ' ma q', 'h', ' wu et al', ' design and application of 60mer oligonucleotide microarray in sars coronavirus detection chin', ' sci', ' bull', ' 48 20031165e1169', '40 x', ' guo p', ' geng q', ' wang et al', ' development of a single nucleotide polymorphism dna microarray for the detection and genotyping of the sarscoronavirus j', ' microbiol', ' biotechnol', ' 24 2014 1445e1454', '41 l', 'k', 'd', ' luna v', ' heiser n', ' regamey et al', ' generic detection of coronavirusesand differentiation at the prototype strain level by reverse transcriptionpcrand nonﬂuorescent lowdensity microarray j', ' clin', ' microbiol', ' 45 20071049e1052', '42 j', ' hardick d', ' metzgar l', ' risen et al', ' initial performance evaluation of aspotted array mobile analysis platform map for the detection of inﬂuenza ab rsv and mers coronavirus diagn', ' microbiol', ' infect', ' dis', ' 91 2018245e247', '43 a', 'v', ' wright j', 'k', ' nunez j', 'a', ' doudna biology and applications of crispr systems harnessing natures toolbox for genome engineering cell 164 201629e44', '44 j', 's', ' gootenberg o', 'o', ' abudayyeh j', 'w', ' lee et al', ' nucleic acid detection withcrisprcas13ac2c2 science 356 2017 438e442', '45 c', 'a', ' freije c', ' myhrvold c', 'k', ' boehm et al', ' programmable inhibition anddetection of rna viruses using cas13 mol', ' cell', ' 76 2019 826e837', '46 j', 's', ' gootenberg o', 'o', ' abudayyeh m', 'j', ' kellner et al', ' multiplexed and portablenucleic acid detection platform with cas13 cas12a and csm6 science 3602018 439e444', '', ''], 'Redox Responsive Biocompatible Nanocarriers': ['asian journal of pharmaceutical sciences 15 2020 8394available online at www', 'sciencedirect', 'comjournal homepage www', 'elsevier', 'comlocateajpsoriginal research paperredoxresponsive biocompatible nanocarriers basedon novel heparosan polysaccharides for intracellularanticancer drug deliverylipeng qiu a1 lu ge a1 miaomiao long b jing mao a kamel s', ' ahmed a xiaotian shan ahuijie zhang a li qin a guozhong lv c jinghua chen aa schoolof pharmaceutical sciences jiangnan university wuxi 214122 chinahigher health vocational technology school wuxi 214028 chinac wuxi third renmin hospital wuxi 214041 chinab wuxiarticleinfo', 'article historyheparosan is a natural precursor of heparin biosynthesis in mammals', ' it is stable in bloodreceived 5 july 2018circulation but can be degraded in lysosomes showing good biocompatibility and long cirrevised 31 october 2018culation features', ' so heparosan can be designed as anticancer drug carriers to increaseaccepted 16 november 2018tumor selectivity and improve the therapeutic effect', ' a novel redoxsensitive heparosanavailable online 17 december 2018cystaminevitamin e succinate ksv micelle system was constructed for intracellular delivery of doxorubicin dox', ' simultaneously the redoxinsensitive heparosanadipic acidkeywordsdihydrazidevitamin e succinate copolymer kv was synthesized as control', ' doxloadedheparosanmicelles doxksv with an average particle size of 90120 nm had good serum stabilityvitamin e succinateand redoxtriggered depolymerization', ' in vitro drug release test showed that doxksv miredoxsensitive micellescelles presented obvious redoxtriggered release behavior compared with doxkv', ' cytotoxdrug deliveryicity and cell uptake were investigated using mgc803 tumor cells and cos7 fibroblastlikecells', ' the cell survival rate of blank micelles was more than 90 and the cytotoxicity ofdoxksv in mgc803 cells was higher than in cos7 cells indicating that the carrier hasbetter biocompatibility and less toxicity side effect', ' the cytotoxicity of doxksv againstmgc803 cells was significantly greater than that of free dox and doxkv', ' furthermorecompared with doxkv in mgc803 cells doxksv micelles uptook more anticancer drugsand then released dox faster into the cell nucleus', ' the micelles were endocytosed by multiple pathways but clathrinmediated endocytosis was the main pathway', ' therefore heparosan polysaccharide could be a potential option as anticancer carrier for enhancing efficacy and mitigating toxicity', ' 2019 published by elsevier b', 'v', ' on behalf of shenyang pharmaceutical university', 'this is an open access article under the cc byncnd license', 'httpcreativecommons', 'orglicensesbyncnd4', '0corresponding author', ' jiangnan university no', ' 1800 lihu road wuxi 214122 china', ' tel', ' 86 510 85329042', 'email address chenjinghuajiangnan', 'edu', 'cn j', 'h', ' chen', 'these authors contributed equally to this work', 'peer review under responsibility of shenyang pharmaceutical university', 'httpsdoi', 'org10', '1016j', 'ajps', '2018', '11', '00518180876 2019 published by elsevier b', 'v', ' on behalf of shenyang pharmaceutical university', ' this is an open access article under thecc byncnd license', ' httpcreativecommons', 'orglicensesbyncnd4', '0', '', 'cancer is a global public health problem', ' in the current treatment of cancer chemotherapy is one of the most importantmethods 1', ' doxorubicin dox an antibiotic anticancer drugis used for multiple cancers such as bladder cancer breastcancer stomach cancer ovarian cancer thyroid cancer lungcancer multiple myeloma and soft tissue sarcoma 24', ' however the poor targeting and serious side effects limit the application of dox 57', ' in order to solve these problems inthe past several decades drug delivery systems dds havebeen developed for the delivery of dox such as liposomesnanoparticles and polymer micelles 810', ' among thempolymer micelles which are easy to prepare and applicableto all hydrophobic drugs have attracted attention due to theirunique advantages', ' polymer micelles are usually composed ofhydrophobic core in which hydrophobic drugs can be loadedand hydrophilic shell which can keep the core away fromthe aqueous environment 11', ' whats more the structurecan greatly increase the solubility and stability of hydrophobic drugs in aqueous solution resulting in enhancing theirbioavailability and blood circulation time', ' and the hydrophilicshell can protect the carrier from reticuloendothelial systemres 1218', ' polymer micelles also can improve the selectivity of tumor tissue through enhanced permeability and retention epr effects to significantly increase the efficiency of anticancer drugs 619', 'the materials for constructing polymer micelle can be divided into natural polymers and synthetic polymers accordingto their sources', ' polyethylene glycol peg is a commonly usedsynthetic material', ' pegylated polymer micelles are widelyused because of their prone to selfassembly small particlesize narrow size distribution and unique shell and shell structure 2021', ' however as the synthetic material peg has poorbiodegradability and biocompatibility', ' peg is metabolized tosome accumulated toxic metabolites in vivo', ' besides studies have found that peg shell can hinder the disassembly ofthe micelles and reduce drug release from tumor cells 2223', 'natural materials have gradually become hotspot polymers tostudy due to their high biocompatibility and biodegradability', ' the natural polymer materials are represented by polysaccharides such as chitosan 24 hyaluronic acid 25 and heparin 26', ' however most of polysaccharides can be degradedby enzyme resulting in short circulation time of nanoparticles in vivo', ' therefore how to design a better delivery system becomes an important issue', ' heparosan hr is a natural precursor to heparin biosynthesis in mammals and aheparinlike material', ' but unlike heparin hr will not be degraded by heparanase in vivo because of the unsulfated oxygensite which endows hr with long circulation effect', ' howeverhr can be degraded by glucuronidase and hexosaminidase tonacetylglucosamine and glucuronic acid in lysosomes', ' thedegradation products are normal monosaccharides in vivo andcan be recycled by cells without accumulation in the tissue27', ' therefore hr has good biocompatibility and hrbaseddrug delivery systems are considered zeroresidue system28', 'after arrival at tumor cell anticancer drugs encapsulatedinto the polymer micelles need to be released in time toachieve their high therapeutic efficiency for tumors 2930', 'some studies also have shown that faster intracellular drugrelease can improve cytotoxicity and overcome mdr 31', 'in recent years environmental stimuliresponsive polymermicelles have been widely used for delivery and controlledrelease of anticancer drugs', ' stimuliresponsive polymer micelles can be triggered by ph temperature enzymes redox potentials light magnetic fields and ultrasound waves3238 to rapidly release the loaded drugs', ' among themredoxsensitive polymer micelles have been widely studiedbecause of the difference redox content between extracellular and tumor cells 3941', ' it is noteworthy that many tumorcells have higher glutathione gsh concentrations than normal cells 42', ' this difference can cause rapid release of activeingredients such as drugs genes and proteins from the redoxsensitive carriers resulting in a stronger therapeutic effect4345', 'in this study highpurity hr polysaccharide obtained by acombination of modern separation and chromatography techniques was used to prepare the redoxsensitive amphiphiliccopolymer', ' vitamin e succinate was linked to polysaccharideby cystatines cys to synthesize heparosancystamine vitamin e succinate ksv copolymers', ' and redoxinsensitiveheparosanadipic acid dihydrazidevitamin e succinate kvcopolymers were synthesized as controls', ' using dox as amodel anticancer drug the properties of blank micelles anddrugloaded micelles were investigated', ' the cytotoxicity andintracellular release of the micelles against mgc803 cells andcos7 cells were evaluated', ' furthermore the internalizationpathways of doxloaded micelles were further tested', ' thepreparation and antitumor effect of doxloaded micelles isshown in scheme 1', '2', 'materials and methods2', '1', 'materialsheparosan was separated and purified in the lab', ' dαtocopherol acid succinate ves nhydroxysuccinimidenhs and 1ethyl33dimethylaminopropyl carbodiimideedc were purchased from aladdin regent co', ' shanghai china', ' adipodihydrazide adh cystamine dihydrochloride cys were provided by energy chemical reagent co', 'ltd shanghai china', ' dimethyl sulfoxide dsmo dithiothreitol dtt pancreatin and penicillinstreptomycin solution were obtained from shanghai songan biotech co', 'ltd shanghai china', ' tetrahydrofuran thf dimethylformamide dmf formamid and triethylamine tea were obtained from shanghai reagent chemical co', ' ltd shanghaichina', ' doxorubicin hydrochloride doxhcl was purchasedfrom dalian meilune biotech co', ' ltd dalian china', ' fetal bovine serum fbs dulbeccos modified eagle mediumdmem and rpmi1640 medium were purchased fromgibco brl maryland usa', ' 345dimethylthiazol2yl25diphenyltetrazoliumbromide mtt was obtained from invitrogen corp', ' 46diamidino2phenylindole dapi were obtained from shanghai beyotime biotechnology co', ' ltd', 'shanghai china', ' all other reagents were of analytical grade', 'asian journal of pharmaceutical sciences 15 2020 839485scheme 1  the preparation and antitumor effect of redoxresponsive doxksv micelles', '2', '2', 'cell culturehuman gastric cancer cells mgc803 and transformedafrican green monkey sv40transformed kidney fibroblastcells cos7 were purchased from chinese academy of sciences shanghai china and grown in dmem gibco usasupplemented with 10 fetal bovine serum fbs 100 mgmlstreptomycin sulfate 100 uml penicillin g sodium', ' cells wereincubated at 37 c in a humidified atmosphere containing 5co2 ', '2', '3', 'synthesis of redoxsensitive ksv copolymerscystaminevitamin e succinate was prepared firstly', ' cystamine dihydrochloride was pretreated by naoh solutionthrough acidbase neutralization 46', ' vitamin e succinate1', '5  104 mol was dissolved in dmf at room temperatureand edc 3  104 mol and nhs 3  104 mol were added tothe solution successively to activate carboxylic groups', ' cystamine 1', '5  104 mol 11 7', '5  104 mol 51 dissolved indmf 5 ml and was dropped into the vitamin e succinate solution stirring for 48 h under a nitrogen atmosphere at roomtemperature', ' after completion the solution was dialyzed inthe dialysis bag mwco 3500 against distilled water for 2 dand then freezedried to obtain cystaminevitamin e succinate', 'then heparosan 1', '5  104 mol was dissolved in formamide', ' after activation of the carboxyl groups heparosan was dropped into the cystaminevitamin e succinate1', '5  104 mol solution and then stirred for 48 h under a nitrogen atmosphere at room temperature', ' after the reactionfinished the mixture was allowed to dialyze in the dialysismembrane mwco 3500 against 25 ethanol solution andpure water and then freezedried to obtain ksv copolymers', '2', '4', 'synthesis of redoxinsensitive kv copolymersas controls the insensitive kv copolymers were also synthesized by two steps', ' firstly adipic acid dihydrazide7', '25  104 mol and edc 2', '5  104 mol were added into theheparosan 1', '25  104 mol solution', ' the ph of mixture solution was adjusted to 4', '75 by 0', '1 m hcl and stirred for 1 h', ' thenthe reaction was ended by the addition of 0', '1 m naoh', ' the solution was dialyzed mwco 3500 in distilled water for 2 d andfreezedried to obtain heparosanadh', 'secondly ves 1', '5  104 mol was dissolved in a mixed solution of dimethylformamide and formamide and activated byedc and nhs', ' heparosanadh 1', '5  104 mol was droppedinto the ves solution and stirred for 48 h under a nitrogenatmosphere at room temperature', ' the reaction solution wasallowed to dialyze in the dialysis membrane mwco 3500against 0', '1 m sodium chloride 25 ethanol solution and purewater and finally freezedried to obtain kv copolymers', '2', '5', 'preparation of doxloaded micellesdoxhcl 10 mg 0', '017 mmol was dissolved in methanol10 ml', ' after adding triethylamine 1 ml the solution wasstirred at room temperature for 24 h', ' the organic solventwas removed by rotary evaporation and then tetrahydrofuran was added to obtain dox base form solution', ' ksv copolymer 10 mg was dissolved in pbs ph 7', '4 10 ml', ' after sufficient dispersion the dox base form solution 2 ml wasslowly dropped into the solution and the mixture solution was86asian journal of pharmaceutical sciences 15 2020 8394stirred overnight in dark', ' doxloaded ksv polymer micellesdoxksv were got after ultrasonic 30 min in an ice bath', ' similarly doxloaded kv polymer micelles doxkv were alsoprepared with the similar method', '2', '6', '2', '7', 'serum stability and redoxtriggered disassembly ofmicellesthe serum stability and redoxsensitive test of the polymermicelles were measured by dynamic light scattering spectrophotometry zetasizer nano zs apparatus malverninstruments uk as described by choi et al', ' with some modification48', ' briefly the micelles were dissolved in ph 7', '4 pbs solution mixed with dmem solution containing 10 fbs and thechanges of size were measured at different times', ' in orderto verify the reductionsensitive of ksv copolymers the micelles were dispersed in gshcontaining pbs solution 10 mmph 7', '4 and tested at programmed times', 'determination of drugloading efficiencyin order to detect the contained drugs free dox was separatedby ultrafiltration firstly', ' dimethyl sulfoxide was added into themicelles to destroy the micellar structure', ' according to thismethod encapsulation efficiency ee and drug loading content dl were tested by an uv spectrophotometer uv2550shimadzu japan with wavelength of 480 nm', 'characterization of the micellesthe average particle size distribution and zeta potential ofthe micelles were investigated by zetasizer nano zs apparatus malverninstruments uk at 37 c', ' the morphology ofdoxksv and doxkv micelles were observed by jem2100tem with acceleration voltage was 80 kv jeo japan', ' typicallythe micelles were dropped onto the copper grid and the solution was evaporated', ' then it was negatively stained with 2phosphotungstic acid before observation', 'the critical micelle concentration cmc of ksv and kvcopolymers was determined by fluorescence spectrophotometer rf5301 pc shimadzu japan with pyrene as a hydrophobic probe 47', ' briefly after pyrene solution completelyevaporated under a nitrogen stream a series of polymer solutions with a concentration of 1', '0  104 to 2', '0 mgml wereadded to the tubes to obtain a final pyrene concentrationof 6', '0  107 m', ' the excitation spectrum of pyrene was determined by fluorescence spectrophotometer and cmc valuewas calculated according to the change of the excitation spectrum', '2', '8', 'culate the cumulative release of dox as followsin vitro reductiontriggered release behaviorsthe release of dox from the both micelles in vitro was testedusing dialysis method', ' the drugloaded micelles were placedinto the dialysis bags mwco 1000 which were immersed in20 ml of different medium at 37 c 100 rmin conditions', ' at apredetermined time point the medium was sampled to calwhere er represents the cumulative release of dox mdox isthe content of the drug in the micelles v0 represents the totalvolume of the release medium ve is the replacement volumeof the release medium and ci represents the drug concentration released at the ith sample', '2', '10', 'in vitro cytotoxicity assaysthe in vitro cytotoxicity of blank micelles and drugloadedmicelles was determined by mtt assay using cancer cellsmgc803 and normal cells cos7', ' briefly cos7 and mgc803 cells were seeded in 96well plates at a density of 5  103 ', 'after incubated for 24 h the prepared blank micelles with aconcentration range of 0500 μgml and drugloaded micelleswith a concentration range of 010 μgml doxkv doxksvwere added to replace the old medium', ' then 100 μl mtt solution was added to each well and incubated for 4 h', ' mtt solution was discarded and dmso 100 μl was added to dissolveblueviolet crystals', ' the absorbance at 570 nm was measuredby using multiskan mk3 microplate reader thermo usa tocalculate the cell viability', ' the ic50 values were calculated using spss 17', '0 chicago il usa', '2', '11', ' observation of the cellular uptake of doxloadedmicellesthe intracellular distribution of free dox doxksv anddoxkv micelles in mgc803 and cos7 cells were observed byconfocal laser scanning microscopy clsm nikon a1r japan', 'mgc803 and cos7 cells were seeded into a laser confocaldish at a density of 1', '5  105 cellswell', ' free dox or drugloaded micelles dox conc entration of 5', '0 μgml were addedand after 1 h 2 h and 4 h of incubation the cells were fixedby 4 paraformaldehyde solution', ' then dapi fluorescent dye20 μgml 30 min was used to make the nucleus visible', ' theremaining dapi fluorescent dye was thoroughly washed withpbs and 300 μl of pbs was added to each well for observationby clsm', '2', '12', 'flow cytometry analysisthe cellular uptakes of free dox doxksv and doxkv micelles in mgc803 and cos7 cells were measured by flow cytometry fcm bd facscalibur', ' the cells were plated in 6well plates at a density of 4  105 cellswell', ' after incubated at37 c and 5 co2 for 12 h the medium was replaced with freedox or drugloaded micelles dox concentration of 5', '0 μgml', 'after incubated for different times the cells were dispersedinto pbs and measured by fcm', '87asian journal of pharmaceutical sciences 15 2020 8394fig', ' 1  1 h nmr spectra of ksv a and kv b copolymers', '2', '13', 'study of the cellular uptake mechanism2', '13', '1', ' effects of atp depletion and low temperature on cellularuptakefcm was used to investigate whether the cellular uptake ofmicelles was energydependent', ' firstly mgc803 cells wereseeded into 6well plates at a density of 3', '0  105 cellswell', 'after incubation of 30 min at 4 c drugloaded micelles doxconcentration of 5', '0 μgml were added into the cells for further 1 h incubation', ' then the cells were dispersed with 500 μlpbs and measured by fcm', ' in the control group the treatmentmethods were the same except that the incubated environment was placed to 37 c and the uptake of the control groupwas set to 100', '88asian journal of pharmaceutical sciences 15 2020 8394fig', ' 3  a serum stability of kv and ksv micelles in dmem containing 10 fbs', ' data were presented as mean  sd n  3', 'b particle sizes distribution of ksv micelles in pbs solution 10 mm gsh ph7', '4 at 0 min 30 min 1 h 2 h and 4 h', 'fig', ' 4  a in vitro redoxdependent release behavior of doxksv micelles in gshcontaining pbs solution 10 mm ph 5', '0', 'b in vitro redoxdependent release behavior of drugloaded micelles in ph 7', '4 pbs and ph 5', '0 pbs with 10 mm gsh at 6 h', 'data were presented as mean  standard deviation n  3', '2', '13', '2', ' effects of endocytosis inhibitors on cellular uptakethe cytotoxicity of each inhibitor to mgc803 cells at theexperimental concentration was determined by mtt assayfirstly', ' mgc803 cells were seeded into 96well plates at a density of 5  103 cellswell for incubation of 24 h', ' and then uptake inhibitors were added with the experimental concentration quercetin 10 μgml 49 chlorpromazine 10 μgml50 colchicine 40 μgml 51 and indomethacin 10 μgml52 were coincubated with mgc803 cells for 2 h', 'then the uptake pathway of drugloaded micelles wasstudied by fcm', ' mgc803 cells were seeded into 6well platesat a density of 3  105 cellswell', ' the inhibitors were addedto replace the old medium and drugloaded micelles doxconcentration of 5 μgml were incubated for 1 h and measured by flow cytometry', ' cells treated with no inhibitor wereused as controls and the fluorescence intensity was set to100', '2', '14', 'statistical analysisthe results were expressed as the mean  standard deviationsd and all experiments were repeated at least three timesindependently', ' the unpaired students test was adopted to determine the statistical significance of differences p  0', '05', 'asian journal of pharmaceutical sciences 15 2020 839489fig', ' 5  cytotoxicity of blank micelles in a mgc803 cells and b cos7 cells', ' cytotoxicity of dox doxkv and doxksv atvarious dox concentrations against c mgc803 and d cos7 cells after incubation for 48 h', ' data were presented asmean  standard deviation n  3', '3', 'results and discussion3', '1', 'ksvsynthesis of redoxsensitive amphiphilic copolymerthe 1 h nmr spectrum of ksv is shown in fig', ' 1', ' the carboxyl groups in heparosan polysaccharide and ves were conjugated to the nh2 groups of cys respectively', ' the typical peaks of glucosamine on heparosan polysaccharide wereshown at 3', '63 ppm 3', '83 ppm and 5', '31 ppm and the typicalpeak of glucosamine methylation on heparosan polysaccharide coch3  was shown at 1', '98 ppm', ' the typical peaksof glucuronic acid on heparosan polysaccharide were shownat 3', '29 ppm 3', '72 ppm and 4', '54 ppm', ' the typical peaks ofmethylene ch2  on the alkanes of ves were shown at 1', '051', '35 ppm and 2', '85 ppm and methyl group ch3  on the phenylring was shown at 2', '63 ppm', ' the typical peaks of the amidegroup conh were shown between 8', '05 and 8', '11 ppm', ' basedon these results it can be confirmed that the amphiphiliccopolymer ksv has been successfully synthesized', '2', '63 ppm is the typical peak of ves ch3  and 5', '31 ppm isthe typical peak of the heparosan polysaccharide', ' the ratioof the integral area between the peaks was used to calculatethe substitution degree of ves', ' two kinds of ksv copolymerswith different substitution ratios were synthesized', ' the substitution degrees were respectively 17 and 21 which wereexpressed by ksv17 and ksv21 ', '3', '2', 'characterization of the micellesthe blank micelles and drugloaded micelles were preparedby the ultrasonic method and their physicochemical properties were characterized', ' the results are shown in table 1', 'with the increase of the substitution degree the particle sizeof both micelles decreased slightly because of the compacthydrophobic core probably', ' however particle sizes of the micelles were shown all below 200 nm and presented a narrowsize distribution fig', ' 2a indicating that the micelles can beeasily targeted to tumor tissue by epr effect', ' the zeta potentialof the micelles was kept at a negative value which could prevent the micelles from aggregation by electrostatic repulsion', '90asian journal of pharmaceutical sciences 15 2020 8394fig', ' 6  clsm images of a cos7 cells and b mgc803 cells after incubation different times with dox doxkv anddoxksv', ' dox was visualized as the red fluorescence nucleuses labeled with hoechst 33342 were shown as the bluefluorescence and the merged showed purple', ' dox concentration was 5 μgml', ' scale bars correspond to 10 μm in all theimages', ' for interpretation of the references to colour in this figure legend the reader is referred to the web version of thisarticle', 'transmission electron microscopy tem fig', ' 2b was shownthat doxksv had a nearly spherical morphology and gooddispersibility', 'as shown in table 1 the drug loading and entrapment efficiency of the micelles were 1315 and 8890 whichmeans all micelles can load drug well', ' as the degree of substitution increased the affinity between the hydrophobic coreand the drug increased so the drug loading and entrapmentefficiency of doxksv21 were slightly greater', ' furthermorethe copolymers had small cmc values which indicate that themicelles have better thermodynamic stability 53 and can exist stably in vivo', '3', '3', 'serum stability and redoxsensitive of ksvstudies have shown that nanoparticle with high polymer content may cause blood coagulation or gelation in vivo 54 so it isnecessary to investigate the stability of nanoparticle in serumfbs at 37 c', ' the average size of the protein in fbs was 10 nmwhich did not affect the measurement of the micelle particlesize', ' as shown in fig', ' 3a after incubation of 48 h in fbs noprecipitates and visible particles were found and there wasno significant increase in the micellar particle size', ' the resultindicates that only a small amount of serum proteins were adsorbed on the micelles and the micelles will not aggregate intolarger particles by absorbing serum proteins after intravenousinjection', ' therefore the copolymer micelles are relatively stable in serum probably due to the generation of a hydrophilicshell', 'the disulfide bond in ksv structure makes it have the characteristic of redoxsensitive', ' in order to determine the redoxsensitive of micelles the particle size of ksv micelles incubated with pbs solution 10 mm gsh ph7', '4 was measured bydynamic light scattering dls method fig', ' 3b', ' it can be seenthat the micelles had a good particle size at the beginning', 'however the particle size was gradually increased with timeextension indicating the micelles could be disassembled andhad obvious redoxsensitive property', '3', '4', 'in vitro redoxsensitive drug release studiesin order to study in vitro release behavior of doxksv anddoxkv ph 7', '4 pbs ph 5', '0 pbs and gshcontaining pbs10 mm ph 5', '0 were used to simulate the normal physiologicenvironment tumor acid environment and tumor intracellular redoxenvironment', ' as shown in fig', ' 4a the cumulative release of dox from both of doxksv micelles in gsh10 mm ph 5', '0 pbs were 82', '33 and 77', '34 respectively', ' thisindicates that the anticancer drug can be effectively releasedfrom the micelles in the tumor cell environment', ' it is worthnoting that the cumulative release of doxksv17 is slightlyhigher than that of doxksv21 p  0', '05', ' this may be due tothe fact that doxksv17 was disassembled faster in the reducing condition', 'in addition further experiments were designed to investigate the effect of gsh on doxksv and doxkv micelles', ' asshown in fig', ' 4b the release amount of doxksv and doxkvin ph 5', '0 was higher than that at ph 7', '4 p  0', '01', ' this difference was probably due to the better solubility of dox at lowph', ' however when gsh was added at 6 h a sudden release ofdoxksv was observed while there was no significant changein the doxkv release', ' this also indicates that the micellarstructure of doxksv was disassembled in the presence ofgsh resulting in the fast release of the drug', ' the above results indicate that doxksv has stable in normal physiological condition but the drug can be released rapidly after arrivalasian journal of pharmaceutical sciences 15 2020 839491fig', ' 7  a mean fluorescence intensities and b flow cytometry analysis profiles of different formulations in cos7 cells', 'c mean fluorescence intensities and d flow cytometry analysis profiles of different formulations in mgc803 cells', ' alldata were presented as mean  sd n  3', ' dox concentration was 5 μgml', 'at tumor cells resulting in enhancing the efficacy of anticancerdrugs', '3', '5', 'in vitro cytotoxicity assaythe mtt assay was used to assess the biocompatibilityof the blank micelles', ' the cell viability of mgc803 cellsfig', ' 5a and cos7 fig', ' 5b cells were exceeded 90 even athigh concentrations 500 μgml suggesting the blank micelleswere virtually nontoxic', ' the cytotoxicity of doxksv anddoxkv against mgc803 cells and cos7 cells is also studied fig', ' 5', ' as the concentration of dox increased both cellviabilities gradually decreased indicating that the cytotoxicity is concentrationdependent for drugloaded micelles', ' forcos7 cells the median inhibitory concentrations ic50  of freedox doxksv17  doxksv21 and doxkv were 1', '752  0', '1344', '931  0', '1622 5', '386  0', '209 and 4', '717  0', '211 μgml respectively', ' there was a significant difference between free doxand micelles p  0', '001 but the cytotoxicity of all the micelle groups was similar', ' because the level of gsh was lowin normal cells the release rate of dox from doxksv wasslow resulting in no significant difference in the ic50 values of doxksv and doxkv micelles', ' however in mgc803 cells the ic50 value of doxksv 1', '003  0', '067 μgml wassignificantly lower than that of doxkv4', '717  0', '211 μgml', 'this could be attributed to the rapid release of dox fromdoxksv resulting from the high concentration of gsh intumor cells', ' it was worth noting that the ic50 value ofdoxksv micelles against mgc803 cells was about 5foldhigher than that of cos7 cells p  0', '001 indicating thatredoxsensitive micelles have better selectivity for tumorcells', '92asian journal of pharmaceutical sciences 15 2020 8394fig', ' 8  a cytotoxicity of the endocytosis inhibitors at the chosen concentration against mgc803 cells', ' b effects of lowtemperature and endocytosis inhibitors on uptake of doxksv and doxkv in mgc803 cells', ' data were presented asmean  standard deviation n  3', '  indicated p  0', '001', '3', '6', 'cellular uptake studyclsm was used to qualitatively investigate the in vitro cellular uptake of doxksv and doxkv in mgc803 cells andcos7 cells', ' after coincubated with free dox doxksv17 doxksv21 and doxkv micelles mgc803 cells and cos7cells were observed by clsm', ' as shown in fig', ' 6 dox wasmainly concentrated in the cytoplasm after incubation for1 h but more drugs were entered into the nucleus in freedox group', ' for all groups the fluorescence intensity of doxincreased after coincubated for 2 h and 4 h', ' it was worthnoting that most of dox in the micelle groups remainedin the cytoplasm after coincubation for 4 h in cos7 cellsfig', ' 6a which indicated that the drugs were not releasedquickly from the micelles', ' however in mgc803 cells fig', ' 6bdox was released gradually from the drugloaded micellesinto the nucleus after coincubated for 2 h', ' and it was notdifficult to see that doxksv disassembled faster and hadstronger fluorescence signal than doxkv which also wascaused by the redoxsensitive behavior of micelles', 'fcm was used to further quantitatively test the cellular uptake of doxksv and doxkv in tumor and normal cells', ' incos7 cells there was no significant difference in the meanfluorescence intensities of doxksv and dox kv fig', ' 7a andb', ' however the cellular uptake of redoxsensitive micelleswas significantly higher than that of redoxinsensitive micelles p  0', '001 in mgc803 cells fig', ' 7c and 7d', ' the resultsindicate that redoxsensitive doxksv micelles can be moreuptaken by tumor cells', '3', '7', 'study of the endocytosis pathwaysin order to determine the potential endocytic pathway of micelles a series of uptake inhibitors were used', ' specificallychlorpromazine is an inhibitor of clathrinmediated endocytosis indomethacin is an inhibitor of caveolaemediatedendocytosis colchicine is an inhibitor of macropinocytosis and quercetin is an inhibitor of clathrincaveolaeindependent endocytosis', ' fig', ' 8a clearly shows the cytotoxicity of each inhibitor to mgc803 cells which indicates thatthe inhibitor had no toxicity with cell viability above 90 atthe experimental concentration', ' therefore cellular uptake inhibition was not caused by inhibitor toxicity', ' then the uptakeof micelles in mgc803 cells after treatment with different inhibitors is shown in fig', ' 8b', ' compared to the control a significant reduction was observed at low temperatures and the uptake rates of doxkv and doxksv decreased to 36', '89 and39', '59 p  0', '001 respectively fig', ' 8 which indicates that theuptake pathway of the micelles is an energydependent pathway', ' in addition the uptake of doxkv and doxksv micellesdecreased to 59', '07 p  0', '001 and 58', '37 p  0', '001 respectively in presence of chlorpromazine', ' and after doxkv anddoxksv treated with colchicine and indomethacin the uptake was decreased to 84', '46 87', '04 p  0', '05 and 87', '2488', '41 p  0', '05 respectively', ' however there was no significant change after treatment with quercetin', ' these results indicate that though clathrin and caveolaemediatedendocytosis both affect cellular uptake of the heparosanbased micelle clathrinmediated endocytosis plays a majorrole', '4', '', '', 'in this study the redoxsensitive heparosanbased amphiphilic copolymers were designed and they selfassembledinto micelles in aqueous solution', ' the doxksv micellescould remain stable under plasma and physiological conditions but dissociate and release dox in the tumor microenvironment', ' so doxksv had reduction sensitivity and couldbe internalized in tumor cells to release more anticancerdrugs rapidly', ' the cytotoxicity of drugloaded micelles in tumor cells was significantly higher than that of normal cellsasian journal of pharmaceutical sciences 15 2020 8394and the redoxsensitive micelles doxksv had more toxicity than redoxinsensitive micelles doxkv in mgc803 cells', 'moreover drugloaded micelles could enter cancer cells moreefficiently compared with normal cells and doxksv disassembled rapidly in tumor cells to release dox', ' in addition alow degree of ksv micelles showed a better antitumor activity', 'the micelles were uptaken into tumor cells via multiple pathways and primarily through clathrinmediated endocytosis', 'therefore redoxsensitive doxksv micelles can effectivelydeliver antitumor drugs to tumors while reducing side effectson normal tissues and heparosanbased polymers have greatpotential as effective drug carriers', 'declaration of interestthe authors report no conflicts of interest', ' the authors aloneare responsible for the content and writing of this article', 'acknowledgmentswe are grateful for the financial support from national natural science foundation of china 81503007 and 21574059research project of wuxi health and family planning commission q201843 natural science foundation of jiangsuprovince bk20170202 and the topnotch academic programs project of jiangsu higher education institutionsppzy2015b146', '', '', '1 ha w zhao xb chen xy jiang k shi yp', ' prodrugbasedcascade selfassembly strategy for precisely controlledcombination drug therapy', ' acs appl mater interfaces201810252114959', '2 zhu c huo d chen q xue j shen s xia y', ' a eutecticmixture of natural fatty acids can serve as the gatingmaterial for nearinfraredtriggered drug release', ' adv mater201729401703702', '3 zhang lh qin y zhang zm fan f huang c lu l et al', ' dualphreductionresponsive hybrid polymeric micelles fortargeted chemophotothermal combination therapy', ' actabiomater 2018751837185', '4 cho hj yoon is hong yy koo h jin yj ko shet al', ' polyethylene glycolconjugated hyaluronicacidceramide selfassemblednanoparticles for targeteddelivery of doxorubicin', ' biomaterials 20123341190200', '5 jia n ye y wang q zhao x hu h chen d et al', ' preparationand evaluation of poly lhistidine based phsensitivemicelles for intracellular delivery of doxorubicin againstmcf7adr cells', ' asian j pharm sci 201712543341', '6 li z tao w zhang d wu c song b wang s et al', ' thestudies of plga nanoparticles loading atorvastatin calciumfor oral administration in vitro and in vivo', ' asian j pharm sci201612328591', '7 danhier f feron o préat v', ' to exploit the tumormicroenvironment passive and active tumor targeting ofnanocarriers for anticancer drug delivery', ' j controlledrelease 2010148213546', '8 kim d zhong gao zg lee es bae yh', ' in vivo evaluation ofdoxorubicinloaded polymeric micelles targeting folatereceptors and early endosomal ph in drugresistant ovariancancer', ' mol pharm 200965135362', 'daglar b ozgur e corman me uzun l demirel gb', ' polymericnanocarriers for expected nanomedicine current challengesand future prospects', ' rsc advance 201448963959', 'zhang x li l li c hua z song h xiong f et al', ' cisplatincrosslinked glutathionesensitive micelles loaded withdoxorubicin for combination and targeted therapy oftumors', ' carbohydr polym 201715540715', 'zhong y goltsche k cheng l xie f meng f deng cet al', ' hyaluronic acidshelled acidactivatable paclitaxelprodrug micelles effectively target and treatcd44overexpressing human breast tumor xenografts in vivo', 'biomaterials 20168425061', 'gong j chen m zheng y wang s wang y', ' polymericmicelles drug delivery system in oncology', ' j control release2012159331223', 'ma n li y xu h wang z zhang x', ' dual redox responsiveassemblies formed from diselenide block copolymers', ' j amchem soc 201013224423', 'kedar u phutance p shidhaye s kadam v', ' advances inpolymeric micelles for drug delivery and tumor targeting', 'nanomedicine 20106671429', 'li j yin t wang l yin l zhou j huo m', ' biological evaluationof redoxsensitive micelles based on hyaluronicaciddeoxycholic acid conjugates for tumorspecific deliveryof paclitaxel', ' int j pharm 2015483123848', 'jiang x li l liu j hennink we zhuo r', ' facile fabrication ofthermoresponsive and reductionsensitive polymericmicelles for anticancer drug delivery', ' macromol biosci201212570311', 'zeng l li y li t cao w yi y geng w et al', ' seleniumplatinum coordination compounds as novel anticancerdrugs selectively killing cancer cells via a reactive oxygenspecies rosmediated apoptosis route', ' chem asian j2014982295302', 'lili y ruihua m li l fei l lin y li s', ' intracellulardoxorubicin delivery of a core crosslinked redoxresponsive polymeric micelles', ' int j pharm201649812195204', 'yang q tan l he c liu b xu y zhu z', ' redoxresponsivemicelles selfassembled from dynamic covalent blockcopolymers for intracellular drug delivery', ' acta biomaterialia201517193200', 'siegwart dj whitehead ka nuhn l sahay g cheng hjiang s et al', ' combinatorial synthesis of chemically diversecoreshell nanoparticles for intracellular delivery', ' proc natlacad sci usa 201110832129963001', 'miteva m kirkbride kc kilchrist kv werfel ta li hnelson ce et al', ' tuning pegylation of mixed micelles toovercome intracellular and systemic sirna delivery barriers', 'biomaterials 20153897107', 'hatakeyama h akita h harashima h', ' a multifunctionalenvelope type nano device mend for gene delivery totumours based on the epr effect a strategy for overcomingthe peg dilemma', ' adv drug deliv rev 201163315260', 'holland jw hui c cullis pr madden td', ' polyethyleneglycollipid conjugates regulate the calciuminduced fusionof liposomes composed of phosphatidylethanolamine andphosphatidylserine', ' biochemistry 1996358261824', 'kim jh kim ys park k kang e lee s nam hyet al', ' selfassembled glycol chitosan nanoparticles for thesustained and prolonged delivery of antiangiogenic smallpeptide drugs in cancer therapy', ' biomaterials20082912192030', 'coradini d pellizzaro c scarlata i zorzet s garrovo cabolafio a et al', ' novel retinoicbutyric hyaluronan ester forthe treatment of acute promyelocytic leukemia preliminarypreclinical results', ' leukemia 200620578592', '94asian journal of pharmaceutical sciences 15 2020 839426 park k kim k kwon ic kim sk lee s lee dyet al', ' preparation and characterization of selfassemblednanoparticles of heparindeoxycholic acid conjugates', 'langmuir 200420261172631', '27 deangelis pl', ' heptune a process of conjugating a naturallyoccurring sugar molecule heparosan to a drug for enhanceddrug delivery', ' drug deliv 20133115', '28 jing w roberts jw green de almond a deangelis pl', 'synthesis and characterization ofheparosangranulocytecolony stimulating factorconjugates a natural sugarbased drug delivery system totreat neutropenia', ' glycobiology 20172711105261', '29 hubbell ja chilkoti a', ' nanomaterials for drug delivery', 'science 201233760923035', '30 guo x shi c wang j di s zhou s', ' phtriggered intracellularrelease from actively targeting polymer micelles', 'biomaterials 20133418454454', '31 gao y chen y ji x he x yin q zhang z et al', ' controlledintracellular release of doxorubicin in multidrugresistantcancer cells by tuning the shellpore sizes of mesoporoussilica nanoparticles', ' acs nano 2011512978898', '32 woraphatphadung t sajomsang w gonil p saesoo sopanasopit p', ' synthesis and characterization ofphresponsive nnaphthylnosuccinyl chitosan micellesfor oral meloxicam delivery', ' carbohydr polym201512199106', '33 yuan w zou h shen j', ' amphiphilic graft copolymers withethyl cellulose backbone synthesis selfassembly andtunable temperatureco2 response', ' carbohydr polym201613621623', '34 naeem m yoo jw', ' withdrawn budesonideloaded enzymeand phsensitive polymeric nanoparticles for the treatmentof colitis', ' asian j pharm sci 20154304637', '35 zhao yp ye wl liu dz cui h cheng y liu m et al', ' redoxand ph dual sensitive bone targeting nanoparticles to treatbreast cancer bone metastases and inhibit bone resorption', 'nanoscale 2017919626477', '36 wang jx yang xz', ' near infrared lightactivatedsupersensitive drug release using nanoparticles with a flowcore', ' j controlled release 2017259145', '37 anirudhan ts christa j binusreejiayan', ' ph and magneticfield sensitive folic acid conjugated proteinpolyelectrolytecomplex for the controlled and targeted delivery of5fluorouracil', ' j ind engin chem 201857199207', '38 papa al korin n kanapathipillai m mammoto amammoto t jiang a et al', ' ultrasoundsensitive nanoparticleaggregates for targeted drug delivery', ' biomaterials201713918794', '39 nguyen thi tt tran tv tran nq nguyen ck nguyen dh', 'hierarchical selfassembly of heparinpeg endcappedporous silica as a redox sensitive nanocarrier fordoxorubicin delivery', ' mater sci eng c mater biol appl201770pt 294754', '40 zhai s hu x hu y wu b xing d', ' visible lightinducedcrosslinking and physiological stabilization ofdiseleniderich nanoparticles for redoxresponsive drugrelease and combination chemotherapy', ' biomaterials20171214154', 'yu ll y mu rh li l liang f yao l su l', ' intracellulardoxorubicin delivery of a core crosslinked redoxresponsivepolymeric micelles', ' int j pharm 201649812195204', 'yang q tan l he c liu b xu y zhu zet al', ' redoxresponsive micelles selfassembled fromdynamic covalent block copolymers for intracellular drugdelivery', ' acta biomater 201517193200', 'lin jt liu zk zhu ql rong xh liang cl wang jet al', ' redoxresponsive nanocarriers for drug and genecodelivery based on chitosan derivatives modifiedmesoporous silica nanoparticles', ' colloids surf bbiointerfaces 20171554150', 'yang hy jang ms li y lee jh lee ds', ' multifunctional andredoxresponsive selfassembled magnetic nanovectors forprotein delivery and dualmodal imaging', ' acs appl materinterfaces 201792218492', 'liu l yi h he h pan h cai l ma y', ' tumor associatedmacrophagetargeted microrna delivery withdualresponsive polypeptide nanovectors for anticancertherapy', ' biomaterials 201713416679', 'wen h dong h liu j shen a li y shi dl', ' redoxmediateddissociation of pegpolypeptidebased micelles forondemand release of anticancer drugs', ' j mater chem b2016448785969', 'choi wi yoon kc im sk kim yh yuk sh tae g', ' remarkablyenhanced stability and function of coreshell nanoparticlescomposed of a lecithin core and a pluronic shell layer byphotocrosslinking the shell layer in vitro and in vivo study', 'acta biomater 201067266673', 'liu c yuan j luo x chen m chen z zhao yet al', ' folatedecorated and reductionsensitive micellesassembled from amphiphilic polymercamptothecinconjugates for intracellular drug delivery', ' mol pharm20141111425869', 'sahay g alakhova dy kabanov av', ' endocytosis ofnanomedicines', ' j control release 2010145318295', 'gersdorff kv sanders nn vandenbroucke r smedt scdwagner e ogris m', ' the internalization route resulting insuccessful gene expression depends on both cell line andpolyethylenimine polyplex type', ' mol ther 200614574553', 'cheng l huang fz cheng lf zhu yq hu q li let al', ' ge11modified liposomes for nonsmall cell lungcancer targeting preparation ex vitro and in vivo evaluation', 'int j nanomedicine 2014992135', 'manunta m tan ph sagoo p kashefi k george aj', ' genedelivery by dendrimers operates via a cholesterol dependentpathway', ' nucleic acids res 200432927309', 'du jz tang ly song wj shi y wang j', ' evaluation ofpolymeric micelles from brush polymer withpolyepsiloncaprolactonebpolyethylene glycol sidechains as drug carrier', ' biomacromolecules2009108216974', 'verma a stellacci f', ' effect of surface properties onnanoparticlecell interactions', ' small 2010611221', '', ''], 'Redox Sensitive  Peg Shielded Carboxymethyl Pei': ['', 'a series of branched polyethylenimine pei modifications including pegylation peg2kpeifor steric shielding redoxsensitive crosslinking for synthesis peg2kpeiss nanogels andsubsequent carboxymethylation peg2kcmpeiss for modulation of the polymer pka havebeen introduced for cellular delivery of antimir21', ' the synthesis was characterized using 1 h nmr ftir tnbs potentiometric titration particle size and ζ potential', ' loading ofantimir21 at various np ratios was investigated by gel retardation ethidium bromide dye', 'microrna pei nanogels antimir21 gene delivery cisplatin resistance', 'ovarian cancer is the 6th most common cancer in women1', ' major risk factors contributing to increase ovarian cancerhave been mentioned as hereditary reproductive hormonalinflammatory dietary and surgical 2', ' indeed it has been reported that hormone replacement therapy can be consideredas the major risk factor for developing ovarian cancer 3', ' regarding that only 30 of ovarian cancer patients at advancedstages can survive only 5 years after initial diagnosis 4 so urgent needs for developing new therapeutic strategies seem tobe undeniable', 'for almost 40 years cisplatin cispt has been the most accepted drug for treating ovarian cancer', ' it has been reportedthat 8090 of patients with ovarian cancer respond to platinum chemotherapy however nearly about one third of themresist to cispt 5', ' various mechanisms of cispt resistancehave been studied which can be divided into pump mediated by pglycoprotein and multidrug resistance proteinsand nonpump mechanisms which are mainly due to antiapoptotic cellular defense activations mediated by bcl2 andsurvivin 67', ' cispt resistance can also occur by elevatingmetallothioneins and glutathione content of the cells', ' in addition increasing dna repair can be considered as an antiappoptotic factor in cispt resistant cells 8', 'micrornas mirnas noncoding endogenous evolutionarily conserved 1822 nucleotide singlestranded rnas werediscovered in 1993 9', ' it has been clear that mirnas havemajor roles in gene expression regulation through base pairformation with messenger rnas 8', ' mirnas biogenesis andtheir mechanisms of action have been well studied and it hasbeen demonstrated that any changes in intracellular amountsof mirna lead to severe diseases including autoimmune malfunctions 10 diabetes 11 parkinsons 12 fibrosis 13 andcardiovascular 14 abnormalities and cancers such as breastglioblastoma liver ovary prostate lung gastric colon and endocrine pancreatic tumors 15', 'microrna21 mir21 has been considered as an oncogenic mirna that upregulates in almost all diseases downregulates tumor inhibitor proteins leads to cell proliferationmigration invasion metastasis and apoptosis regulation 16', 'several studies demonstrate that mir21 overexpression leadsto downregulation of critical tumor inhibitor proteins suchas phosphatase and tensin homolog pten programmed celldeath protein 4 pdcd4 hypoxia inducible factor1α hif1αand regulates drug resistance in ovary cancer cells 1721', 'so delivery of antimir21 to ovarian cancer cells seems tobe a promising way to inhibit tumor cell proliferation andmetastasis', 'it has been reported that upregulation of mir21 in ovarian cancer is responsible for cispt resistance in cancer cellsby pdcd4 upregulation via jnk1cjunmir21 pathway 22', 'the most important challenge to achieve convenient therapeutic approaches for mirantimir therapy is lack of suitable delivery system which can overcome the obstacles ofsystemic delivery such as phagocytic elimination renal filtration nucleases degradation cellular uptake and endosomal release for possible translation to clinical practice', 'peis have wide applications for gene delivery because oftheir controlled polycationic nature which allow them tocondense negatively charged oligonucleotide chains protectthem against nucleases and facilitate nucleic acid enteringefficiently via endocytosis 2526', ' moreover peis increase endosomal escape attributed to the wellknown proton spongemechanism 2728', ' chemical modifications of pei primaryand secondary amines can enhance endosomal release of genetic materials by decreasing pka that makes the modifiedpolymer more protonable at acidic than neutral ph 2930', ' inaddition it has been shown that addition of carboxyl groupsinduces proton sponge effect since ionized carboxylate groupsserve as protonacceptors and enhanced buffer capacity ofnanovectors 31', ' also the nanogels composed of pegpei caneffectively deliver drug or oligonucleotide due to the positivelycharged core of pei and the shell of mpeg which leads to solubility enhancement rapid endosomal uptake prevention ofunwanted interactions of particles with plasma componentsand nuclease protection 3234', ' in addition these stericallystabilized nanoscale particles can easily provide a convenientenvironment for encapsulation of negatively charged biological agents such as mirnas to promote their resistance againstchanges in ph ionic strength and solvent 3335', ' simultaneously biodegradable crosslinking provides the demanded stability of a relatively new generation of nanovectors also callednanogels that causes protection of loaded oligonucleotidechains', ' furthermore redoxsensitive disulfide linkages facilitate their breaking down and intracellular release of encapsulated contents in presence of glutathione and reducing enzymes of the cells but prevent premature release and degradation in the extracellular milieu 3437', 'in this regard we aimed to synthesis a series of branchedpei modifications including pegylation reaction peg2kpeifor steric shielding redoxsensitive chemical crosslinkingpeg2kpeiss for nanogel preparation and subsequent carboxymethylation reaction peg2kcmpeiss for modulationof the polymer pka  respectively', ' to investigate the possiblerole of disulfide crosslinks and the carboxymethylation reaction the physicochemical and biological properties of thenanogels were compared in terms of loading antimir21 formation of stable nanoplexes cellular delivery and transfectionefficiency', ' in addition the therapeutic value of antimir21loaded peg2kpeiss nanogels was compared in a2780 sensitive a2780s and resistant a2780r cell lines to cispt', 'polyethyleneimine 10 kda corresponding to mw mn of 1', '4and methoxy polyethylene glycol 2 kda mpeg2000 coohwere purchased from poly sciences inc', ' canada and jenkemusa respectively', ' dithiodipropionic acid dtdp 13dimethylaminopropyl3ethylcarbodiimide hydrochlorideedc nhydroxysuccinimide nhs 246trinitrobenzene sulfonic acid tnbs disodium ethylenediaminetetraacetic acidedta agarose 46diamidino2phenylindole dapi fluorescein isothiocyanate fitc sodium borohydride nabh4 4morpholineethanesulfonic acid mes cisplatin cisptand345dimethylthiazol2yl25diphenyltetrazoliumbromide mtt were supplied from sigmaaldrich usa', 'znso4 ', '7h2 o dichloromethane dcm dimethylsulfoxidedmso triethylamine tea ethidium bromide etbr andpotassium bromide kbr were obtained from merck germany', ' a2780s and a2780r ovarian cancer cell lines werepurchased from pasteur institute iran tehran', ' antimir21 scrambled and primer sequences were synthesized bymacrogen korea', 'lyophilized products with kbr and compression of the mixtures to form discs', ' twenty scans were signal averaged with aresolution of 4 cm1 in range of 5004000 cm1 ', 'coordination complex micellar templateassisted synthesisand characterization of peg2kpeiss was carried out according to the previous method by abolmaali et al', ' 3338', ' brieflya solution of nhsactivated mpeg2000 cooh in methanol wasadded to pei solution in dcm at mpeg2000 pei weight ratiosat 0', '5', ' the medium was supplemented by 1 tea as a proton quencher and the tubes were incubated for 3 h while stirring', ' the product was concentrated using a rotational speedvacuum christ rvc 218 germany diluted in 3 ml of deionized water dialyzed using a floatalyzer 68 kda spectrumusa and lyophilized christ alpha 12 ld germany', ' for thecrosslinking reaction 30 mg of peg2kpei dissolved in 100 mmmes buffer ph 5', '6 znso4 solution was added dropwise tothe polymer solution zn2 n ratio  0', '2 and stirred 30 min toconstitute a micellar template for the crosslinking reaction', 'the crosslinking reaction was done by adding100 mm dtdpsolution in dmso edc and nhs at the molar ratio of 221nhsedccooh', ' the mixture was stirred overnight and thenthe coordinated zn2 was removed by dialysis against hcl solution ph 3', '0 using floatalyzer 3', '5 kda', '2', '3', 'carboxymethylation reactionto carboxylate pei primary and secondary amines buried inthe core of peg2kpeiss nanogels a solution of 12 mg bromoacetic acid in 3 ml dmso was added dropwise to 4 mlnanogels 2', '5 mgml', ' the product peg2kcmpeiss was thenstirred overnight at room temperature and then dialysis indouble distilled water for 3 d and stored in 4 c before use', 'nmr spectra was recorded on bruker400 mhz using d2 oas solvent', ' proton integration method was used to estimateaverage degree of pegylation disulfide crosslinking and carboxymethylation', 'potentiometric titrationthe potentiometric titration was performed to estimate thedegree of carboxymethylation', ' briefly aliquots of 20 μl of 1 mnaoh solution were added to solutions of peg2kpei peg2kpeiss and peg2kcmpeiss nanogels equals to 1 mg pei', ' eachmixture was titrated with aliquots of 0', '5 m hcl while shakingat 25 c', ' the titration curves were plotted and compared forthe nanogels', '2', '4', '5', 'ellman assayto determine the redoxsensitivity of the nanogels either simple or carboxylated ellman assay was performed 40', ' briefly25 μl of the reagent 0', '2 m nabh4 in 0', '2 naoh solution weremixed to 45 μl of samples containing 4 mm total amines andincubated for 1 h', ' the volume reached to 90 μl with 300 mmhepes buffer ph 8', ' then 10 μl of 4 mgml dtnb solutionellmans reagent was added', ' after 15 min incubation theabsorbance was read at 412 nm', ' the free thiol content wascalculated using a calibration curve plotted for reduced glutathione standard solutions', '2', '5', 'preparation and characterization of antimir21loaded nanogels2', '5', '1', 'gel retardation assaynanoplexes were prepared by simple mixing of antimir21or scramble sequences with peg2kpei copolymer peg2kpeiss and peg2kcmpeiss nanogels at various np ratios rangingfrom 0 to 10 in deionized water', ' the products were further incubated for 0', '5 3 6 and 24 h at room temperature', ' nanoplexeswere run in biorad electrophoresis apparatus at 60 v 30 minin 2', '5 wv agarose gel and visualized by uv transilluminator syngene gel documentation system 41', '2', '5', '2', 'to calculate the amount of residual primary amines in peg2kpei copolymer peg2kpeiss and peg2kcmpeiss nanogelstnbs assay was performed according to the method describedby freedman and radda 39 at polymer concentrations equalto 0', '75 mm pei', ' to 0', '5 ml of each standard and sample solutions diluted in 0', '1 m borate buffer ph  9', '5 2', '6 μl tnbsreagent was added', ' following 45 min incubation at 25 c theabsorbance was read at λ  420 nm using uvvisible spectrophotometer elisa reader biotek usa', 'ethidium bromide etbr dye exclusion assayetbr dye exclusion assay was performed to determine the optimum np ratio for loading and condensation of nucleic acidsequences 42', ' nanoplexes were prepared according to theaforementioned method in 96well plates', ' after 30 min incubation at room temperature 50 μl of 0', '5 μgml of etbr solution was added to each sample and mixed gently', ' the mixtures were incubated in dark condition for 15 min and thefluorescence intensity was read at excitation and emissionλ  510 nm and λ  595 nm respectively', ' naked antimir21sequence and deionized water were considered as positiveand negative controls respectively', 'ftir spectroscopyinfrared spectra were recorded on ftir spectrometer vertexbruker germany to study spectral changes', ' samples wereprepared by geometric dilution of an identical amount of theheparin sulfate competition assayto investigate stability of the antimir21 loaded nanoplexesagainst heparin sulfate extracellular polyanion agaroseasian journal of pharmaceutical sciences 15 2020 6982gel electrophoresis was performed', ' in this condition thenanoplexes were prepared at various np molar ratios and themixtures were incubated for 24 h at room temperature', ' then2 μl of heparin sulfate 2 uμg oligonucleotide was added toeach sample pipetted several times and after 15 min incubation they were run in 2', '5 agarose gel at 60 v for 30 min', 'the bands were visualized using syngene gel documentationapparatus', ' in parallel biological stability of the nanoplexeswas investigated by measuring their resistance against heparin sulfate by the etbr dye exclusion assay', ' briefly 0', '12 iuheparin sulfateμg oligonucleotide sequences were added toeach well of 96well plate containing nanoplexes', ' after 15 minincubation 50 μl of 1 μgml etbr was added to each well', ' fluorescence intensities were determined before and after addition of heparin sulfate as mentioned before and any changein nucleic acid condensation  were calculated accordingly', '2', '5', '4', 'stability of nanoplexes against dnaseito investigate the biological stability of nanoplexes againstnucleases the nanoplexes at the np  5 and also 3 μg of nakedantimir21 were mixed with 2 μl of reaction buffer and 2 u ofdnasei separately', ' the mixtures were incubated at 37 c fordifferent times 0 min 1 3 6 and 24 h', ' aliquots at differentincubation times were run in 2', '5 agarose gel electrophoresis and their stability against dnasei was compared to nakedantimir21 43', 'determination of particle size and ζ potentialparticle size was investigated by the dynamic light scatteringspectrometry dls 180 microtrac germany using a patentedcontrolled reference method which incorporates 180 heterodyne detection by calculating signals of various scattered lightfrequencies combined with the reflected signals of unshiftedfrequency of the original laser 780 nm to generate a widespectrum of frequencies', ' the power spectrum of doppler frequency shifts was then applied for the multimodal and broadsize distribution measurements', ' the hydrodynamic diameters of the nanogels and their respective nanoplexes withantimir21 were determined in 20 mm phosphate bufferph  7 at the effective np molar ratio  5', ' the viscosity andrefractive index of water at 25 c were used for data analysis', 'the intensity averaged diameters were reported for each sample', ' to calculate ζ potentials the diluted samples underwentcell culturecellular studies were carried out using a2780s and a2780rovarian cancer lines', ' the cells were cultured in rpmi mediumsupplemented with 10 fetal bovine serum fbs paa australia and 1 antibiotic penicillinstreptomycin australiain an incubator at 37 c and 5 co2 ', ' in order to preserve theresistance phenotype aliquots of 0', '1 μm cispt was added toa2780 drug resistance cell line after each passage', 'mtt cytotoxicity assaya cell count of 2', '5  104 a2780r and a2780s cells was seededin 96well plates', ' after 24 h incubation at 37 c and 5 co2 the cells were treated with the culture medium containingvarious concentrations of peg2kpei copolymer peg2kpeissand peg2kcmpeiss nanogels at the concentrations rangedbetween 0 and 100 μgml to evaluate cytotoxicity of thepolymeric biomaterials', ' furthermore the mtt assay wasperformed to investigate the sequence specific cytotoxicity associated with antimir21 vs', ' scrambled sequence100 ngml loaded with the nanogels at different np moleratios 1 3 5 for 72 h', ' the medium was replaced with 100 μlmtt 0', '5 mgml in pbs and incubated for a further 3 h', ' finallythe medium was aspirated and the remaining formazan crystals were solubilized in 100 μlwell dmso', ' light absorbancewas measured at 570 nm and corrected for the backgroundabsorbance at 650 nm', ' cell viability was calculated as percentage relative to untreated control cells 44', 'trypan blue membrane leakage assaya2780r and a2780s cells were seeded 106 cellswell in6well plates', ' after 24 h the cells were incubated with solutions of the polymers alone peg2kpei peg2kpeiss andpeg2kcmpeiss nanogels at the concentration of 32 mglor the loaded nanoplexes prepared at the constant np  53 μgl antimir21 or the scrambled sequence', ' next the cellswere trypsinized and suspended in pbs containing trypanblue and counted to determine the percentage of viable cellswith clear cytoplasm vs', ' nonviable cells blue stained cytoplasm', ' cell membrane leakage was expressed as the percentage of nonviable to total cells', ' untreated cells served ascontrol 45', '2', '6', '3', ' cellular uptake and intracellular release by fluorescencemicroscopycellular uptake of the fitclabeled nanogels was determinedby fluorescence microscopy', ' first to label the nanogels 200 μlof 10 mgml fitc was added to 4 ml of the nanogels 1', '3 mgmlin 0', '1 m borate buffer ph 9', '2 and the mixture was incubatedfor 2 h stirring', ' the excess fitc was removed by dialysis usingfloatalyzer 810 kda at 4 c in dark', ' the degree of conjugation was determined using standard curve plotted for fitc atλ  495 nm', ' then 105 cells a2780r and a2780s were seededin 6well plates and treated for 0', '5 2 and 4 h with either50 μgml fitclabeled nanogels', ' following treatment the cellswere washed with cold pbs and fixed with 2 paraformaldehyde in pbs at 37 c for 10 min', ' after washing with cold pbsthe cells were permeabilized with triton x100 0', '5 in pbsfor 10 min at 4 c and washed with cold pbs', ' the nuclei werestained with dapi solution 10 μgml in pbs for 5 min beforevisualized by the fluorescence microscope nikon eclipse e400japan', 'mir21 expression assay by stemloop rt pcrafter 24 h incubation of the seeded cells in 6well platesthe cells were treated by nanoplexes with np  5 molar ratios for 72 h', ' then the cells were scrapped and total rnawas extracted according to dena zist asia kit procedure', 'cdna synthesis was done using mmulvreverse transcriptase and special stemloop primer for microrna21 30 min16 c 60 min 42 c followed by 10 min 70 c', ' polymerase chainreaction pcr was done with the following pattern 94 c for2 min followed by 4060 cycles of 93 c for 30 s 58 c for 1 minand 72 c for 30 s', ' the products were run on 2', '5 agarose gelat 60 v for 30 min', ' results were analyzed by imagej software', '2', '7', 'interaction between mir21 downregulation andcispt resistancein order to evaluate the effect of treating cells with antimir21 loaded nanoparticles on cispt action the sensitive and resistant cells were pretreated with antimir21 nanoplexesfor 48 h', ' following the treatment the media were aspiratedand replaced by a medium containing 5 or 10 μm cispt', ' after 24 h mtt assay was performed according to the aforementioned method', 'in order to discriminate live apoptotic and necrotic cells under fluorescent microscope acridine orange ao ethidiumbromide etbr doublestaining assay was performed', ' 7  105cellswell of a2780s and a2780r cells were seeded in 24wellplates treated with the nanoplexes np  5 for 72 h', ' thenthe cells were trypsinized stained with aoetbr dye mix inpbs 100 μgml and observed under fluorescent microscopenikon eclipse e400 japan 46', 'statistical analysis was performed using prism softwareversion 5', '0 graphpad usa', ' p values less than 0', '05 wereconsidered statistically significant', ' data were expressed asmean  standard deviation', 'physicochemical characterization of the nanogelsin present study to investigate the effects of structural variation of peg2kpei copolymer on transfection of antimir21 synthesis of peg2kpeiss nanogels containing redoxsensitive crosslinks 33 and the carboxymethylated nanogelspeg2kcmpeiss have been done', ' synthesis of peg2kpeicopolymer and the peg2kpeiss nanogels were confirmed by1 h nmr ftir and dls methods as reported previously 33', 'following the carboxymethylation reaction tnbs assay wasused in order to monitor changes in the concentration of primary amine residues 4748 considering that the reactionsinvolves often the pei primary amines 49', ' using the calibration curve plotted for standard glycine solutions it was foundthat about 14', '7 of the peg2kpei primary amines were consumed to produce simple nanogels and 87', '0 of the remaining amines were used to produce peg2kcmpeiss nanogelsso less than 10 of the available primary amines were onlypresent in chemical structure of the resulting nanogels butstill sufficient for the fluorescent labeling of nanogels 50', 'following the carboxymethylation reaction the chemical structure of nanogels were investigated by ftir and 1 hnmr spectroscopy', ' the peaks at 3420 1113 and 1669 cm1is attributed to nh co and amide co stretching of peipeg2k and the crosslinker dtdp in the peg2kpeiss nanogelsrespectively', ' after carboxymethylation reaction the uniquefig', ' 1  backtitration curve of peg2kpei copolymerpeg2kpeiss and peg2kcmpeiss nanogels at a quantitycorresponding to 1 mg pei after supplementing the mediumdouble distilled water ddw with 20 μl of 1 n naoh', 'broad peak at 25003000 cm1 appears that is related tothe hydroxyl group of carboxylic acid moieties suplementarydata as reported before 51', ' the degree of carboxymethylation was determined by 1 h nmr', ' the peaks at 3', '4 and 2', '33', '3 ppm are related to ch2 o of peg and ch2 n of pei inthe spectrum of the peg2kpeiss nanogel', ' the specific peakof ch2 ch2 cooh in the peg2kcmpeiss nanogel structureis also located at 2', '33', '3 ppm so the area under the curveof this range increased suplementary data', ' degree of carboxymethylation was estimated about 44 for total primaryand secondary amines', 'potentiometric titration was performed to determine thevariation in buffer capacity of peg2kpei copolymer followingsynthesis of the nanogels at the concentration corresponding to 3', '3 mgml pei fig', ' 1', ' it was revealed that the titrationcurves shifted to the right following the crosslinking reaction peg2kpeiss', ' a further shift in acidic ph occurred after carboxymethylation reaction that is responsible not onlyfor increasing the buffering capacity and endosomal escapeproperties but also for reducing the cytotoxicity inducedby the positively charged nanoparticles 51', ' the maximumbuffer capacity was determined in ph 5', '3 corresponding topka of the carboxylic acid groups that exist in the core ofpeg2kcmpeiss nanogels 52', 'ellmans assay method was done for determination of freethiols recovered after treating the nanogels with a reducingagent nabh4 ', ' unlike untreated polymers the free thiol concentrations were determined 0', '14  0', '02 and 0', '10  0', '01 mmfor peg2kpeiss and peg2kcmpeiss nanogels respectively', 'the concentrations of recovered free thiols were consistentwith estimated density of the crosslinks', '3', '2', 'biological characterization of the nanoplexesgel retardation assay was carried out to investigate thenanoplex formation after adding antimir21 to peg2kpei74asian journal of pharmaceutical sciences 15 2020 6982fig', ' 2  gel retardation assay at various incubation times and np ratios lanes from left to right 0 0', '5 1 2 5 10', 'fig', ' 3  retardation of antimir21 loaded in the nanoplexes at various np ratios lanes from left to right 0 0', '5 1 2 5 10with or without adding heparin sulfate', 'peg2kpeiss or peg2kcmpeiss nanogels using agarose gelelectrophoresis 53', ' retardation of the oligonucleotide bandwas noticed by increasing np ratios and the incubation timeuntil no residual naked oligonucleotide band was seen inthe gel as reported by others 54', ' depending on the chemical nature and structure of the polymers the optimum npmolar ratio was different 55', ' in our experiment at low npratios of 0', '51 the cationic charge was insufficient to neutralize and condense the negatively charged antimir21 even after long incubation times as reported elsewhere 54', ' howeverupon increasing np ratios as well as the incubation time themigration of antimir21 was retarded in the gel so that nomigration happens in the gel for np as low as 5 and aprolonged incubation time of 324 h indicating a completeneutralization of antimir21 negative charge through a complete nanoplex formation fig', ' 2', ' the nanoplexes formedalmost completely with peg2kpei copolymer and peg2kpeiss nanogels similarly at np ratio as low as 2 but therequired incubation times were different 3 h vs', ' 24 h forthe uncrosslinked copolymer and the nanogel respectivelyfig', ' 2', ' the np ratio shifted to the higher value of 5 for peg2kcmpeiss nanogels', ' a relatively prolonged incubation time isrequired for antimir21 loading into the nanogels possiblydue to crosslinks in the polycation network that can hinderdna penetration for subsequent complex formation as reported by hartlieb et al', ' 56', 'biologic stability of nanoplexes is a prerequisite for successful transfection', ' it has been reported that biologic stability of nanoplexes is related to polymer structure and npratio 50', ' so the nanoplexes were exposed to heparin sulfate for determination of possible nucleic acid displacement57', ' in this issue the nanoplex structure can be disruptedand antimir21 may be released following exposure to theextracellular matrix due to the polyanionic nature of heparin sulfate 58', ' as shown in fig', ' 3 unlike the peg2kcmpeiss nanogels that resist against heparin sulfateinduced displacement of oligonucleotides at np ratio  10 no displacedoligonucleotide band was seen at np ratio as low as 5similarly for the uncrosslinked peg2kpei and peg2kpeissnanogels indicating a complete protection against extracellular matrix', ' so the results suggest that the crosslinking reaction provides convenient networks to capture antimir21and lessen displacement induced by heparin sulfate', ' althoughthere are generally more accessible cationic amines in the uncrosslinked polycation peg2kpei than the nanogels peg2kpeiss and peg2kcmpeiss to condense and neutralize negative charges of antimir21 the instability is less prominentfor peg2kpeiss nanogel possibly due to adequacy of the network structure to prevent heparin sulfate interaction', 'etbr dye exclusion assay was also carried out in orderto analysis of the nanoplex formation and the resistanceagainst heparin sulfate 59', ' intercalation of the etbr withasian journal of pharmaceutical sciences 15 2020 698275fig', ' 4  a etbr dye exclusion assay', ' b', ' polyanion competition assays after adding heparin sulfate', '   symbols representstatistically significant differences between treatments for each np ratio  p  0', '05  p  0', '01', 'fig', ' 5  dnase i digestion assay in agarose gel at various incubation times lanes from left to right 0 1 3 6 24 h', 'oligonucleotides results in fluorescence intensity enhancement which decreases upon adding polycations as a resultof the fluorescent probe exclusion from their intercalationsites 576061', ' the fluorescence intensity of intercalated etbrwas determined at different np ratios', ' as shown in fig', ' 4aby increasing the np ratios the fluorescence intensity decreased indicating oligonucleotide sequestration by the polycations', ' however peg2kpeiss nanogel was the most efficientpolymer in capturing antimir21 oligonucleotide the difference was more recognized at np  2', ' for further characterization of the nanoplexes polyanion heparin sulfate competition assay was performed', ' fig', ' 4b shows that heparin sulfate triggered the release of antimir21 oligonucleotide fromthe nanoplexes', ' peg2kpeiss nanogels show a better condensation of antimir21 than uncrosslinked peg2kpei andless efflux of the loaded antimir21 following heparin sulfatetreatment', ' it was believed that introduction of carboxylatenegative charge through carboxymethylation of the nanogelspeg2kcmpeiss may decrease competitive binding of thenanogels to condense and protect antimir21', ' therefore at asufficient nanogel concentration np  5 no practically significant efflux of the oligonucleotide was seen', '3', '3', 'stability of nanoplexes against dnase idnase i digestion assay was done to evaluate antimir21 protection provided by the polycations against nucleases at npof 5', ' fig', ' 5 shows that although all polycations can protect theoligonucleotide against enzymatic degradation peg2kpeissand peg2kcmpeiss nanogels were more efficient than uncrosslinked peg2kpei copolymer in protecting antimir21after prolonged incubation times', ' this might be as the resultof slow penetration of high molecular weight nucleases intothe pegylated nanogel network provided by crosslinking reactions 62', '3', '4', 'particle size and ζ potentialcolloidal properties particle size and ζ potential of thenanogels and the resulting nanoplexes are among the factorsthat determines stability transfection activity and biocompatibility', ' particle size and ζ potential values were determined before and after loading antimir21 at np  5', 'as presented in table 1 ζ potentials of the nanogels areinversely correlated with the protonable amine density', ' although less aggregation may occur for the higher ζ zetapotentials due to greater electrostatic repulsion no colloidalinstability was determined for peg2kcmpeiss', ' moreover theparticle sizes was determined less than those of peg2kpeiss possibly due to salt bridges between amines and carboxylate moieties resided within the nanogel structure', ' following polyplex formations reduction of the sizes and ζ potentials probably arises from the formation of tight complexeswith antimir21 63 that were determined identical for theuncrosslinked copolymer and the nanogels at np ratio of 5', 'although the mechanism by which oligonulcoetide interactswith peg2kpei may differ from the crosslinked structures nomtt assaycytotoxicity of polycations is almost a challengeable factorfor successful gene delivery 64', ' to investigate first the cytocompatibility of nanogels the cell viability was determined bya mtt assay of the intracellular metabolic activity and b trypan blue exclusion assay that depends on the integrity of thecellular membrane', ' then the sequencespecific cell growthinhibition induced by the antimir21 loaded nanogels wasinvestigated as a function of np mole ratios np  1 2 and5 in a2780s and a2780r cell lines', ' as shown in fig', ' 6a and6b neither peg2kpei copolymer nor the nanogels showed anysignificant cytotoxicity at concentrations as low as 10 μgmlp  0', '05', ' however their cytotoxicity increased by the polymer concentration so that the cell viability decreased significantly at 50 and 100 μgml in both a2780s p  0', '0001 anda2780r p  0', '01 cells', ' in addition it was revealed that thecytotoxicity of peg2kcmpeiss nanogels at the concentration of 100 μgml was significantly lower than peg2kpeissnanogels in a2780s and a2780r p  0', '0001', ' the cytotoxicityresults can be explained according to primary amine contentsof the polycations 5165 which cause interactions with negatively charged molecules located on the cell surface 64', ' it hasbeen shown that crosslinking of peg2kpei reduces cell toxicity significantly due to coreshell structure of the nanogelsthat provides a better peg shielding 33', ' on the other handcarboxymethylation of the nanogels further improves the cellcompatibility which may be due to reduced pka of peg2kpeiand higher buffer capacity of peg2kcmpeiss in acidic ph asdemonstrated in fig', ' 1', ' the lower pka leads to reduced protonation of the nanogels and the lower positive ζ potentials atphysiologic ph table 1 that lessons the cell toxicity 5166', 'treatment than a2780s p  0', '05', ' treatment of a2780s cellswith peg2kpei peg2kpeiss and peg2kcmpeiss nanogelsloaded with antimir21 at np  5 led to cell viability decrement if compared to unloaded nanoparticles by 4 p  0', '0524 p  0', '0001 and 35 p  0', '0001 respectively while thedecrements were determined more in a2780r cell lines 11p  0', '01 28 p  0', '0001 and 47 p  0', '0001 respectively', 'the nanogels loaded with the scrambled sequence did notshow any significant effect on the cell viability', ' treatinga2780s cells with peg2kpei peg2kpeiss and peg2kcmpeiss nanogels loaded with antimir21 at np  5 led to cell viability decrement while the decrements were determined morein a2780r cell lines which can be explained by the abbarentexpression of mir21 in a2780r compared to a2780s cell lines', '3', '5', '2', 'cell membrane leakage assaytrypan blue membrane leakage assay was done in order to examine whether the nanogels either alone or after loading withantimir21 at np  5 brought about toxic effects on a2780cell lines that led to the cell membrane leakage and the celldeath', ' table 2 shows the cell viability changes when incubated with the nanogels for a prolonged period of 24 h', ' unlikethe nanogel treatment alone that showed a modest toxicitythe antimir21 nanoplexes prepared at the correspondingnanogel concentration np  5 produced significant toxicityp  0', '05', ' the effect was more pronounced for peg2kcmpeiss nanogels similarly in a2780s and a2780r cells that maybe due to efficient delivery of antimir21 causing loss of cellmembrane integrity 67', '3', '6', 'cellular uptake and intracellular releasefollowing nanoplex formation the oligonucleotide chargeneutralization and condensation happens that can promoteoligonucleotide interaction with the negatively charged cellmembrane and cause cellular internalization especially athigh np ratios 6869', ' the cellular uptake of nanoplexes77is mainly energy dependent through different mechanismssuch as clathrinmediated endocytosis 38', ' after having incubated the cells for 1 h with fitclabeled polycations the fluorescence microscopy experiment was performed that showsgreen fluorescence in cytoplasm due to cellular binding andendosomal uptake in a2780 cell lines fig', ' 7a', ' the fluorescence was more intense in a2780r than a2780s cells', ' cytoplasmic localization of the polycations was found after staining the nuclei by dapi blue color to make the requiredcontrast', ' the green dotted pattern was noticed in the proximity of cell membranes for the polycations having cotreatedthe cells with dextranfitc', ' more uniform green fluorescencewas observed 4 h after treating the cells indicating endosomal release into cytoplasm fig', ' 7b', ' the release was morearound the cell nuclei for peg2kcmpeiss in comparison topeg2kpei and peg2kpeiss nanogel', ' carboxymethylation ofpeg2kpei nanogels lowers pka and increases buffer capacityof the nanogels in more acidic ph of late endosomes fig', ' 1therefore the endosomal escape can occur more effectivelyfar from the cell membrane and more close to the nucleus possibly through wellknown proton sponge mechanism 27', ' tofurther investigate the endosomal release colocalization experiment of the fitc labeled nanogel with lysotracker is suggested', '3', '7', 'mir21 expressioncellular uptake and endosomal release of antimir21 canresult in mir21 knockdown as reported elsewhere 70', ' relative expression levels of mir21 after treating a2780s anda2780r cell lines with antimir21 and the scrambled sequence either naked or loaded in the nanogels are shown infig', ' 8a', ' the results clearly demonstrate that the loaded antimir21 downregulated mir21 expression whereas the loadedscrambled sequence or the naked antimir21 did not showany significant effects as reported elsewhere 71', ' this resultindicates the gene knockdown is sequencespecific and needsneutralization of the negative charge of antimir21 for asuccessful transfection 71', ' the efficiency of gene silencingwas absolutely more remarkable in a2780r than a2780r cells', 'moreover the downregulation of mir21 was more evidentin the cell lines treated with antimir21 loaded in peg2kcmpeiss nanogels', ' no changes in ßactin expression thehousekeeping gene as shown in fig', ' 8b was detected', ' as reported in literature the positive charges enhance cells interactions cellular uptake and endosomal release 70 that mightresult in mir21 knockdown', ' on the other hand enhancedendosomal release as presented in fig', ' 7b might have significant effects in cytoplasmic release of antimir21 and consequently microrna21 downregulation', '3', '8', 'effect of mir21 downregulation on cispt resistanceit has been revealed that mir21 overexpression is directly related to drug resistance 17207275', ' cispt treatment alone did not exert any significant cytotoxicity either in a2780s or a2780r in the concentrations below 20 μmfig', ' 9a', ' as shown in fig', ' 9b treating cells with cispt after 48 h incubation with antimir21 loaded nanogels sensitized cells remarkably to cispt even in its low concentrations78asian journal of pharmaceutical sciences 15 2020 6982fig', ' 7  images of the internalized fitclabeled polymers in a2780r and a2780s cell lines cellular uptake after 1 hincubation a and endosomal release of fitcdextran cotreated with the polymers after 4 h incubation b at 37 c allfigures were overlaid with dapi stained cell nuclei', 'fig', ' 8  a expression of mir21 in a2780s and a2780r cell lines 72 h after treatment with antimir21 a or the scrambledsequence s either naked or the nanoplexes prepared with peg2kpei copolymer peg2kpeiss and peg2kcmpeissnanogels', ' b expression of ß actin', 'asian journal of pharmaceutical sciences 15 2020 6982795 and 10 μm', ' this observation can be explained by the research finding that downregulation of mir21 could sensitizea2780r to cispt through downregulation of pten expressionand jnk1cjunmir21 pathway 18', ' indeed it has been revealed that a2780r is more sensitive in response to antimir21 treatment than a2780s at np  5 that may be due to theaberrant mir21 expression in a2780r compared to a2780sfig', ' 9b 18', '3', '9', 'fig', ' 9  a viability of a2780s and a2780r cell lines aftertreatment with cispt in the range of 2200 μm', ' b viabilityof the cells pretreated with antimir21 loaded nanogelsnp  5 and after treatment with cispt', ' abbreviations rand s represent a2780r and a2780s cells respectively', ' thesymbols denote statistically significant differences from theleast cytotoxic treatment  p  0', '05  p  0', '01 p  0', '001 and  p  0', '0001', 'live  dead assayas demonstrated in fig', ' 10 live cells with normal morphology can be observed in the untreated control or thescrambled sequence loaded nanogels', ' on the other handearly and late apoptotic cells were recognized in the cellstreated with antimir21 loaded peg2kcmpeiss nanogels42  6', '4 and 56  1', '6 of live cells in a2780r and a2780srespectively', ' thus cellular dna damage mediated by apoptosis and secondary necrosis was remarkably induced after antimir21 loaded peg2kcmpeiss nanogels treatmentfig', ' 10 probably because of enhanced endosomal release ofantimir21 as presented in fig', ' 7b which can potentiate theexpression of tumor suppressor pdcd4 and revoked apoptosisinhibitor ciap2 22', '', 'various pei modifications including peg2kpei copolymerpeg2kpeiss and peg2kcmpeiss nanogels have been prepared to improve transfection of antimir21', ' although the vs', ' untreated control cells', ' green live cells showed normal morphology yellowishgreen early apoptotic cells showednuclear margination and chromatin condensation while late orange apoptotic cells showed fragmented chromatin andapoptotic bodies', ' crosslinking and carboxymethylation reactions decrease primary amine contents of the peg2kpei needed for oligonucleotide charge neutralization and condensation protonationof primary amines at physiologic ph and the general cytotoxicity are diminished', ' moreover the nanogels can effectivelyprotect antimir21 against extracellular matrix and alsodnase digestion', ' notably an enhanced endosomal escapeand transfection efficiency are determined for the nanogels', 'therefore peg2kcmpeiss nanogels is proposed as a potential nanovector for antimir21 delivery and a basis for futuredual delivery with chemotherapeutic agents', ' investigation ofcellular trafficking of the nanogels the biologic consequencesof mir21 downregulation and molecular mechanisms of cispt chemosensitization by the nanoplexes are suggested forfurther study', 'acknowledgmentsthis work was supported financially by shiraz university ofmedical sciences grant no sums9301058630', ' the facilitysupports of center for nanotechnology in drug delivery aregratefully acknowledged', 'supplementary materialssupplementary material associated with this article can befound in the online version at doi10', '1016j', 'ajps', '2018', '10', '006', '', '', '1 baru l patnaik r singh kb', ' clinico pathological study ofovarian neoplasms', ' ijrcog 20176343844', '2 hunn j rodriguez gc', ' ovarian cancer etiology risk factorsand epidemiology', ' clin obstet gynecol 201255323', '3 hempling re wong c piver ms natarajan n mettlin cj', 'hormone replacement therapy as a risk factor for epithelialovarian cancer results of a casecontrol study', ' obstetgynecol 199789101216', '4 ries lag', ' ovarian cancer survival and treatment differencesby age', ' cancer 1993715249', '5 andrews pa velury s mann sc howell sb', 'cisdiamminedichloroplatinum ii accumulation insensitive and resistant human ovarian carcinoma cells', 'cancer res 1988486873', '6 ikeguchi m nakamura s kaibara n', ' quantitative analysis ofexpression levels of bax bcl2 and survivin in cancer cellsduring cisplatin treatment', ' oncol rep 2002911216', '7 ganesh s iyer ak weiler j morrissey dv amiji mm', 'combination of sirnadirected gene silencing with cisplatinreverses drug resistance in human nonsmall cell lungcancer', ' mol ther nucleic acids 20132e110', '8 pillai rs', ' microrna function multiple mechanisms for a tinyrna rna 200511175361', '9 lee rc feinbaum rl ambros v', ' the c', ' elegansheterochronic gene lin4 encodes small rnas with antisensecomplementarity to lin14', ' cell 19937584354', '10 dai r ahmed sa', ' microrna a new paradigm forunderstanding immunoregulation inflammation andautoimmune diseases', ' transl res 201115716379', '11 sekar d venugopal b sekar p ramalingam k', ' role ofmicrorna 21 in diabetes and associatedrelated diseases', 'gene 20165821418', '12 saghazadeh a rezaei n', ' microrna machinery in parkinsonsdisease a platform for neurodegenerative diseases', ' expertrev neurother 201515127', '13 ge y chen g sun l liu f', ' microrna29 and fibrosis diseases', 'zhong nan da xue xue bao yi xue ban 20113690812', '14 cao ry li q miao y zhang y yuan w fan l et al', ' theemerging role of microrna155 in cardiovascular diseases', 'biomed res int 2016201615', '15 calin ga croce cm', ' micrornacancer connection thebeginning of a new tale', ' cancer res 20066673904', '16 javanmardi s reza aghamaali m sadat abolmaali smohammadi s mohammad tamaddon a', ' mir21 anoncogenic target mirna for cancer therapy molecularmechanisms and recent advancements in chemo andradioresistance', ' curr gene ther 20161637589', '17 chan jk blansit k kiet t sherman a wong g earle cet al', ' the inhibition of mir21 promotes apoptosis andchemosensitivity in ovarian cancer', ' gynecol oncol201413273944', '18 echevarríavargas im valiyeva f vivasmejía pe', 'upregulation of mir21 in cisplatin resistant ovarian cancervia jnk1cjun pathway', ' plos one 20149e97094', '19 liu s fang y shen h xu w li h', ' berberine sensitizesovarian cancer cells to cisplatin through mir21pdcd4 axis', 'acta biochim biophys sin 20134575662', '20 xie z cao l zhang j', ' mir21 modulates paclitaxel sensitivityand hypoxiainducible factor1α expression in humanovarian cancer cells', ' oncol lett 20136795800', '21 li j jiang k zhao f', ' icariin regulates the proliferation andapoptosis of human ovarian cancer cells throughmicrorna21 by targeting pten reck and bcl2', ' oncol rep201533282936', '22 chan jk blansit k kiet t sherman a wong g earle cet al', ' the inhibition of mir21 promotes apoptosis andchemosensitivity in ovarian cancer', ' gynecol oncol201413273944', '23 aied a greiser u pandit a wang w', ' polymer gene deliveryovercoming the obstacles', ' drug discov today 20131810908', '24 lollo cp banaszczyk mg chiou hc', ' obstacles and advancesin nonviral gene delivery', ' curr opin mol ther 2000213642', '25 baker a saltik m lehrmann h et al', ' polyethylenimine peiis a simple inexpensive and effective reagent for condensingand linking plasmid dna to adenovirus for gene delivery', 'gene ther 1997477382', '26 meneksedagerol d tang t uludag h', ' probing the effect ofmirna on sirnapei polyplexes', ' j phys chem b2015119547586', '27 benjaminsen rv mattebjerg ma henriksen jr moghimi smandresen tl', ' the possible proton sponge effect ofpolyethylenimine pei does not include change in lysosomalph', ' mol ther 20132114957', '28 søndergaard rv mattebjerg ma henriksen jr moghimi smandresen tl', ' the possible proton sponge effect ofpolyethylenimine pei does not include change in lysosomalph', ' mol ther 20132114957', '29 thomas m klibanov am', ' enhancing polyethyleniminesdelivery of plasmid dna into mammalian cells', ' pnas200299146405', 'asian journal of pharmaceutical sciences 15 2020 698230 oskuee rk philipp a dehshahri a wagner e ramezani m', 'the impact of carboxyalkylation of branchedpolyethylenimine on effectiveness in small interfering rnadelivery', ' j gene med 20101272938', '31 sakae m ito t yoshihara c iidatanaka n yanagie heriguchi m et al', ' highly efficient in vivo gene transfection byplasmidpei complexes coated by anionic peg derivativesbearing carboxyl groups and rgd peptide', ' biomedpharmacother 20086244853', '32 hoffmann c stuparu mc daugaard a khan a', ' azamichaeladdition reaction postpolymerization modification andpreparation of peipegbased polyester hydrogels fromenzymatically synthesized reactive polymers', ' j polym sci apolym chem 2015537459', '33 abolmaali ss tamaddon am dinarvand r', ' nanohydrogelsof methoxy polyethylene glycolgrafted branchedpolyethyleneimine via biodegradable crosslinking ofzn2 ionomer micelle template', ' j nanopart res 2013152134', '34 najafi h abolmaali ss owrangi b ghasemi ytamaddon am', ' serum resistant and enhanced transfectionof plasmid dna by pegstabilized polyplex nanoparticles oflhistidine substituted polyethyleneimine', ' macromol res20152361827', '35 raemdonck k demeester j de smedt s', ' advanced nanogelengineering for drug delivery', ' soft matter 2009570715', '36 dunn ss tian s blake s et al', ' reductively responsivesirnaconjugated hydrogel nanoparticles for gene silencing', 'jacs 2012134742330', '37 creusat g rinaldi as weiss e elbaghdadi r remy jsmulherkar r et al', ' proton sponge trick for phsensitivedisassembly of polyethyleniminebased sirna deliverysystems', ' bioconjug chem 2010219941002', '38 abolmaali ss tamaddon am mohammadi s amoozgar zdinarvand r', ' chemically crosslinked nanogels of pegylatedpoly ethyleneimine lhistidine substituted synthesized viametal ion coordinated selfassembly for delivery ofmethotrexate cytocompatibility cellular delivery andantitumor activity in resistant cells', ' mater sci eng c materbiol appl 201662897907', '39 freedman rb radda gk', ' the reaction of 2 46trinitrobenzenesulphonic acid with amino acids peptidesand proteins', ' biochem j 196810838391', '40 bir k crawhall jc mauldin d', ' reduction of disulfides withsodium and potassium borohydrides and its application tourinary disulfides', ' clin chim acta 19703018390', '41 köpinghöggård m vårum km issa m danielsen schristensen be stokke bt et al', ' improvedchitosanmediated gene delivery based on easily dissociatedchitosan polyplexes of highly defined chitosan oligomers', 'gene ther 200411144152', '42 lepecq jb paoletti c', ' a fluorescent complex betweenethidium bromide and nucleic acids physicalchemicalcharacterization', ' j mol biol 19672787106', '43 mahmoodi m behzadbehbahani a sharifzadeh sabolmaali ss tamaddon a', ' cocondensation synthesis ofwelldefined mesoporous silica nanoparticles effect ofsurface chemical modification on plasmid dnacondensation and transfection', ' iet nanbiotechnol2017119951004', '44 gerlier d thomasset n', ' use of mtt colorimetric assay tomeasure cell activation', ' j immunol methods 1986945763', '45 strober w', ' trypan blue exclusion test of cell viability', ' currprotoc immunol 2001211a', '3b', '1a', '3b', '2', '46 ciniglia c pinto g sansone c pollio a ', ' acridineorangeethidium bromide double staining test a simple invitro assay to detect apoptosis induced by phenoliccompounds in plant cells', ' allelopathy j 2010263018', '8147 santos jl pandita d rodrigues j pêgo ap granja plbalian g et al', ' receptormediated gene delivery usingpamam dendrimers conjugated with peptidesrecognized by mesenchymal stem cells', ' mol pharmaceut2010776374', '48 snyder sl sobocinski pz', ' an improved 2 46trinitrobenzenesulfonic acid method for the determinationof amines', ' anal biochem 1975642848', '49 stocks sj jones ajm ramey cw brooks de', ' a fluorometricassay of the degree of modification of protein primaryamines with polyethylene glycol', ' anal biochem19861542324', '50 abolmaali ss tamaddon am kamalisarvestani eashraf mj dinarvand r', ' stealth nanogels of histinylated polyethyleneimine for sustained delivery of methotrexate incollageninduced arthritis', ' model pharm res20153210330923', '51 dehshahri a oskuee rk shier wt hatefi a ramezani m', 'gene transfer efficiency of high primary amine contenthydrophobic alkyloligoamine derivatives ofpolyethylenimine', ' biomaterials 200930418794', '52 sundberg rj martin rb', ' interactions of histidine and otherimidazole derivatives with transition metal ions in chemicaland biological systems', ' chem rev 197474471517', '53 soshilov aa denison ms', ' dna binding gel retardationassay analysis for identification of aryl hydrocarbon ahreceptor agonists and antagonists', ' in caldwell gw yan zyeditors', ' optimization in drug discovery in vitro methods', 'totowa nj humana press 2014', ' p', ' 20719', '54 scott v clark ar docherty k', ' the gel retardation assay', ' inharwood aj editor', ' protocols for gene analysis', ' totowa njhumana press 1994', ' p', ' 33947', '55 golkar n samani sm tamaddon am', 'cholesterolconjugated supramolecular assemblies of lowgenerations polyamidoamine dendrimers for enhanced egfpplasmid dna transfection', ' j nanopart res 201618107', '56 hartlieb m pretzel d kempe k fritzsche c paulus rmgottschaldt m et al', ' cationic poly 2oxazoline hydrogels forreversible dna binding', ' soft matter 201394693704', '57 kleemann e neu m jekel n fink l schmehl t gessler tet al', ' nanocarriers for dna delivery to the lung based upona tatderived peptide covalently coupled to pegpei', ' jcontrol release 2005109299316', '58 tavakoli s tamaddon am golkar n samani sm', 'microencapsulation of deoxythymidine 20dotapcomplexes in stealth liposomes optimized by taguchidesign', ' j liposome res 2015256777', '59 geall aj blagbrough is', ' rapid and sensitive ethidiumbromide fluorescence quenching assay of polyamineconjugatedna interactions for the analysis of lipoplexformation in gene therapy', ' j pharm biomed anal20002284959', '60 zintchenko a philipp a dehshahri a wagner e', ' simplemodifications of branched pei lead to highly efficient sirnacarriers with low toxicity', ' bioconjug chem 200819144855', '61 fischer d bieber t li y elsässer hp kissel t', ' a novelnonviral vector for dna delivery based on low molecularweight branched polyethylenimine effect of molecularweight on transfection efficiency and cytotoxicity', ' pharm res19991612739', '62 zheng n song z liu y zhang r zhang r yao cet al', ' redoxresponsive reversiblycrosslinked thiolatedcationic helical polypeptides for efficient sirnaencapsulation and delivery', ' j control release 20152052319', '63 venault a huang yc lo jw chou cj chinnathambi ahiguchi a et al', ' tunable pegylation of branchtype peidnapolyplexes with a compromise of low cytotoxicity and highasian journal of pharmaceutical sciences 15 2020 6982transgene expression in vitro and in vivo gene delivery', ' jmater chem b 20175473244', 'brunot c ponsonnet l lagneau c farge p picart cgrosgogeat b', ' cytotoxicity of polyethyleneimine peiprecursor base layer of polyelectrolyte multilayer films', 'biomaterials 20072863240', 'malik n wiwattanapatapee r klopsch r lorenz k frey hweener jw et al', ' dendrimers relationship betweenstructure and biocompatibility in vitro and preliminarystudies on the biodistribution of 125ilabelledpolyamidoamine dendrimers in vivo', ' j control release20006513348', 'fischer d li y ahlemeyer b krieglstein j kissel t', ' in vitrocytotoxicity testing of polycations influence of polymerstructure on cell viability and hemolysis', ' biomaterials200324112131', 'louis ks siegel ac', ' cell viability analysis using trypan bluemanual and automated methods', ' mammalian cell viability', 'springer 2011', ' p', ' 712', 'gao s tian h guo y li y guo z zhu x et al', ' mirnaoligonucleotide and sponge for mirna21 inhibitionmediated by peipll in breast cancer therapy', ' acta biomater20152518493', 'delivery and mir21 gene silencing to overcome tumormultidrug resistance in vitro', ' plos one 20138e60034', 'foged c brodin b frokjaer s sundblad a', ' particle sizeand surface charge affect particle uptake by humandendritic cells in an in vitro model', ' int j pharm2005298231522', 'shim ms kwon yj', ' efficient and targeted delivery of sirna invivo', ' febs j 2010277481427', 'drayton rm', ' the role of microrna in the response tocisplatin treatment', ' portland press limited 2012', 'eitan r kushnir m lithwickyanai g david mb hoshen mglezerman m et al', ' tumor microrna expression patternsassociated with resistance to platinum based chemotherapyand survival in ovarian cancer patients', ' gynecol oncol20091142539', 'titone r morani f follo c vidoni c mezzanzanica disidoro c', ' epigenetic control of autophagy by micrornas inovarian cancer', ' biomed res int 20142014343542', 'bourguignon lyw', ' overcoming chemotherapy resistance bytargeting hyaluronancd44mediated stem cell markernanog signaling and microrna21 in breast ovarian andhead and neck cancer', ' in hayat editor', ' stem cells andcancer stem cells volume 9 therapeutic application indisease and injury', ' dordrecht springer 2013', ' p', ' 2918', '', ''], 'Regorafenib Loaded Poly  Lactide Co Glycolide  Microspheres': ['', 'transarterial chemoembolization tace has been widely introduced to treat hepatocellularcarcinoma hcc especially for unresectable patients for decades', ' however tace evokesan angiogenic response due to the secretion of vascular endothelial growth factor vegfresulting in the formation of new blood vessels and eventually tumor recurrence', ' thus weaimed to develop regorafenib regoloaded poly lactidecoglycolide plga microspheresthat enabled localized and sustained drug delivery to limit proangiogenic responses', 'microspheres transarterial chemoembolization', 'transarterial chemoembolization tace are broadly usedagainst hepatocellular carcinoma hcc especially forinoperable patients for decades 12', ' conventional taceusually involves intraarterial administration of contrastmedium and chemotherapeutic drugs via a catheter underimage guidance followed by embolization of the tumorfeeding artery with embolic agents e', 'g', ' gelatin spongedegradable starch microspheres', ' for tace with drugeluting beads debtace chemotherapeutic drugs wereencapsulated into the embolic microspheres prior to theirtransarterial delivery which could execute dualmissions ofoccluding the selected vessels and controlling drug release', 'the embolic microspheres are usually classified into thenonbiodegradable and biodegradable which could both beapplied for tace 34', '', 'the strategy of tace can deliver high doses ofchemotherapeutic drugs to tumors and also induce localischemia and hypoxia via arterial embolization whichresult in tumor necrosis and shrinkage', ' however thisischemic or hypoxic variation of hcc after tace inducesthe expression of vascular endothelial growth factor vegfupregulation and proangiogenic responses leading toneoangiogenesis and eventually tumor recurrence 57', 'thus tace in combination with antiangiogenic agentscan decrease posttace angiogenesis and improve tacetherapy for hcc in theory', ' there have been a number ofclinical trials conducted in this area', ' most of them arecombined regimens of oral antiangiogenic agents andtace', ' these clinical trials results are inconclusive someof them proved to be safe and promising 810 whilethe others were controversial and needed further research1113', ' compared to oral antiangiogenic agents local deliveryof microspheres loaded antiangiogenic agents together withtace might offer a promising therapeutic regimen forhcc with potentially enhanced therapeutic efficacy oftace meanwhile reduced systemic exposures through drugentrapment in tumorfeeding vessels', 'as an oral multikinase inhibitor regorafenib regoprovides antiangiogenic activity in various tumor typesby the inhibition of vascular endothelial growth factorreceptors vegfr tyrosine kinase with immunoglobulinand epidermal growth factor homology domain 2 tie2 plateletderived growth factor receptorβ pdgfrβand fibroblast growth factor receptor fgfr', ' the activityis correlated with suppression of cell proliferation andinduction of apoptosis by the inhibition of oncogenickinases kit ret raf1 braf and mutant braf 1314', 'it was approved for treating gastrointestinal stromal ormetastatic colorectal cancer mcrc by the us food anddrug administration fda 1516', ' in 2017 fda approvedrego for a secondline therapy in previously sorafenibtreated hcc patients 17', ' some commercial productsof nonbiodegradable microspheres have come into thermarket already such as dc beadsand hepaspheretm fortace', ' drugs especially the positively charged were usuallyshielded by ion exchange approach and the drug elutionkinetics were determined by the ionic environment ofphysiological fluids 418', ' compared with nonbiodegradablemicrospheres the biodegradable might expand the types ofdrug loading with adjustable drug release kinetics 1920', 'rego is a hydrophobic drug that cannot be shielded intoraforementioned microspheres dc bead hepaspheretm ', 'in order to formulate rego for tace we developednew biodegradable drug loading microspheres', ' thesemicrospheres could better fine tune the flexible loadingand release of the drug', ' as a biodegradable polymer approvedby fda polylactidecoglycolide plga has been widelyapplied in the preparation of various drug delivery platformssuch as microspheres implants and in situ forming depotsdue to its biocompatibility and tunable properties 2122', ' thepotential of plga microspheres prepared for tace have beenreported in several studies 2325', 'we aimed to develop regoloaded plga microspheresfor improvement of tace therapeutic effects which cansustainably deliver rego to limit proangiogenic responses inliver tumors after tace', ' plga microspheres were preparedvia the emulsionsolvent evaporation method with acosolvent system', ' physicochemical characterization ofmicrospheres and the in vitro drug release were furtherinvestigated', ' subsequently the type and proportion ofcosolvent were optimized', ' in order to confirm the role ofregoloaded microspheres tailored to combine controlledlocal delivery and tace we introduced injectable miriplatinas chemotherapeutic drug used in tace', ' miriplatin is a highlylipophilic platinum derivative that can be delivered andsuspended in lipiodol for tace in hcc treatment 2627', ' thein vitro biological activity in groups of blank microspheresrego microspheres miriplatin and rego microspheres plusmiriplatin has been further assessed for cytotoxicity andantiangiogenic efficacy', ' in vivo pharmacokinetics of regomicrospheres and miriplatin were preliminarily evaluated inhealthy adult new zealand white male rabbits', ' the in vivoantitumor effects have also been investigated in hepg2 tumormodels', 'plga mw 34 000 da lactic acidglycolic acid ratio 5050was purchased from evonik industries essen germany', 'please cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciencespolyvinyl alcohol pva mw 30 00070 000 da was fromguoren yikang technology company beijing china', 'regorafenib and miriplatin for injection were kindly giftedfrom hefei industrial pharmaceutical institute co', ' ltd', 'hefei china', ' mtt kit was bought from sigmaaldrichrco', ' st louis usa', ' matrigelmatrix was from corningdiscovery labware inc', ' bedford usa', ' rpmi 1640 mediumfetal bovine serum fbs penicillin streptomycin solutionpenstrep endothelial cell culture medium ecm andendothelial cell growth supplement ecgs were purchasedfrom life technologies corporation grand island usa', 'deionized water used in the experiments was preparedby a millipore milliq water purification system bedfordusa', ' unless otherwise specified all the chemicals wereprovided by sinopharm chemical reagent co', ' ltd', ' shanghaichina', '2', '2', 'cell lines and culture conditionshuman hepatocarcinoma hepg2 cells were purchased fromprocell life science co', ' ltd', ' wuhan china', ' miriplatinresistant human hepatocarcinoma hepg2 cells hepg2miriwere established from their parental hepg2 cells by usingpulse treatment with high concentration of miriplatincombining treatment with miriplatin of low concentrationgradually increased and maintained in the presence of0', '2 μgml miriplatin', ' hepg2 cells and hepg2miri cells werecultured in rpmi 1640 medium supplemented with 10fbs 100 μgml streptomycin and 100 uml penicillin', ' humanumbilical vascular endothelial cells huvecs from sciencellresearch laboratories carlsbad ca usa were maintained inecm medium containing 5 vv fbs and 1 vv ecgs', ' allcells were incubated at standard cell culture condition 37 cwith 5 co2 ', '2', '3', 'animalsthe balbc nude mice 20  2 g were purchased from theshanghai lingchang biotechnology co', ' ltd shanghai china', 'adult new zealand white male rabbits 2', '0  0', '2 kg werepurchased from nanjing qinglongshan animal breeding co', 'ltd nanjing china', ' animals were housed with a naturallightdark cycle and acclimatized for 1 week prior tostudy', ' the rabbits were fasted 12 h before the study', ' theanimal studies were approved by the china pharmaceuticaluniversity animal ethics committee', '2', '4', 'determination of rego solubilityrego solubility in dichloromethane dcm ethyl acetateea acetone ac and dimethylformamide dmf weredetermined by incubating excess rego in 1 ml of eachsolvent at 25 c in a constant temperature air bath shakerat 100 rpm rpm for 24 h', ' rego and solvent mixturewere centrifuged for 10 min at the speed of 12 000 rpm toseparate supernatant then the supernatant were filteredusing syringe filters clarinerttm  nylon 0', '22 μm', ' the filteredsupernatant was diluted with the separated solvents andanalyzed by ultra performance liquid chromatography uplcusing waters acquity hclass milford usa', ' briefly 1 μl ofthe supernatant was injected onto a waters beh c18 column100 mm  2', '1 mm 1', '7 μm with the column temperature of35 c', 'the mobile phase was acetonitrilewater 7030 vv atthe flow rate of 0', '2 mlmin and the detection wavelength was265 nm', '2', '5', 'preparation of rego microspheresthe controlled release microspheres of rego were preparedby oilinwater ow emulsionsolvent evaporation method', 'plga 350 mg and a specific amount of rego 12150 mg wereused in each of the formulation', ' plga and rego were bothdissolved in predesignated 5 ml organic solvents table 1followed by mixing using a vortex mixer', ' the solution wasemulsified in 300 ml 1 pva solution in a 1000 ml beaker bystirring at 500 rpm for 3 min with a magnetic stir bar', ' thestirring step was maintained at 200 rpm for 16 h to reachcomplete solvent evaporation', ' after 10 min and 1500 rpmcentrifugation the samples were further processed byvacuum filtration washed with deionized water four timesand desiccated by freezelyophilized overnight to obtain themicrospheres', 'moreover rego microspheres were prepared by varyingthe ratios of dmf and dcm', ' briefly plga 350 mg and aspecific amount of rego 150 mg were dissolved with the 5 mlmixture of dmfdcm table 2', ' the preparation method ofmicrospheres is the same as the method described above', ' theblank microspheres were prepared using the same methodexcept that rego was not added', '2', '6', 'characterization of blank and rego microspheressamples of rego blank microspheres physical mixtureof rego with blank microspheres and regoloadedmicrospheres were analyzed via infrared ir spectranicolet is10 thermo fisher massachusetts usa', ' thesamples were scanned in the range from 400 to 4000 cm1 ', 'please cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001jid ajps4article in pressadditionally xray powder diffraction xrd techniquewas applied to analyzing above four groups by xraydiffractometer smartlab3 rigaku tokyo japan', ' thesamples were measured with the diffraction angle from5 to 80 2θ angle', '2', '7', 'morphology and particle sizethe surface morphology and shape of the microsphereswas investigated through scanning electron microscopysem hitachi s3700 n hitachi tokyo japan', ' microspheresamples were mounted on the doublesided conductiveadhesive attached to the sample plate and sputtercoatedwith gold', ' particle size was measured with laser scatteringdevice mastersizer 2000 malvern instruments malvernuk', ' the respective samples were suspended in water andsubsequently wet measurements of the microspheres sizewere performed', ' particle size expressed as volume weightedmean diameter', 'as hepg2mirirego 0 hepg2mirirego 0', '5 hepg2mirirego 1', '0 and hepg2mirirego 2', '0', 'the resistant cell lines abovementioned and hepg2 cellswith a density of 5  103 cellswell were inoculated into 96well microplates', ' after treatment with miriplatin as designedthe ic50 of each cell line was determined by mtt method', 'after adding 20 μl mtt solution 5 mgml to each well andthe plate was incubated for 4 h at 37 c', ' the supernatants wereremoved and dmso were added to dissolve the formazanproduct', ' cell viability was analyzed by microplate readerpower wave tm xs biotex northern vermont usa at570 nm', ' cell viability  was calculated as od of testgroupod of control group  100', ' to study the effect ofrego on drug resistance of hepg2 induced by miriplatinthe ic50 values of miriplatin towards the resistant cell linesand hepg2 cells were determined', ' the resistance index wascalculated as the ic50 of the resistant cell lines divided by theic50 of hepg2 cells', '2', '11', '2', '8', 'in vitro cytotoxicity studiesdrug loading evaluationfor drug loading assessment 2 ml of dcm was added to 25 mgrego microspheres accurately weighed in 50 ml screwcaptube and soaked in a field of ultrasonic waves for 15 minwith occasional shaking', ' mobile phase acetonitrilewater7030 vv was added to dilute to volume followed byfiltration using syringe filters clarinerttm  nylon 0', '22 μm', 'the amount of rego encapsulated was evaluated by the uplcmethod as described above', ' the drug loading capacity lcwas calculated as loaded amount of rego divided by thetotal microspheres weight', ' the loading efficiency le wascalculated as the loaded rego divided by the total regoamount feeding for encapsulation', '2', '9', 'm7may 23 2020235asian journal of pharmaceutical sciences xxx xxxx xxxin vitro release studiesthe automatic dissolution tester sotax at 7smart onlinesystem sotax basel switzerland were applied to evaluatingcontrolled release behavior of rego microspheres', ' it wasstudied using the paddle method with stirring speed at100 rpm', ' the dissolution medium used was 800 ml ph 7', '4phosphate buffer containing 2 sodium dodecyl sulfatemaintained at 37', '0  0', '5 c', ' approximately 10 mg of regomicrospheres were immersed in the dissolution medium atpredetermined time intervals 1 h 4 h 8 h 12 h 1 d 2 d 4 d 6d 8 d 10 d 12 d 16 d 20 d 25 d and 30 d 5 ml samples werewithdrawn and 5 ml fresh media was added', ' after filteringthrough syringe filters clarinerttm  mcm 0', '22 μm the regoconcentration in the filtrate were determined by the uplcmethod as described above', '2', '10', ' effect of rego on drugresistance of hepg2 inducedby miriplatinin the process of establishing drugresistant cells hepg2mirihepg2 cells were divided into four groups and induced bymiriplatin in the presence of rego at concentrations 00', '5 1', '0 2', '0 μmoll showing no or low cytotoxicity on thehepg2 cells', ' the resistant cell lines are named accordinglyin vitro cytotoxicity of groups of blank microspheres regomicrospheres miriplatin and rego microspheres plusmiriplatin against hepg2 cells were assessed by mtt assay', 'the four groups of samples were incubated in cell culturemedium for 1 d 3 d and 7 d at 37 c respectively after whichsupernatants were collected', ' the hepg2 cells with a densityof 5  103 cellswell were inoculated into 96well microplatesand treated with the supernatants for 48 h', ' the cytotoxicityof cells to samples was measured as previously describedmtt method', '2', '12', 'in vitro huvecs tubeformation assaythe effect of released rego on angiogenesis was evaluated byhuvecs tubeformation assay', ' after thawed on ice for 24 hdiluted matrigel was added into 96well plates 50 μl per wellthen placed plates on ice bags for 10 min cultured for 1 h at37 c to allow solidify', ' 2  104 huvecs in ecm supplementedwith 2 vv fbs 1 vv ecgs 50 μlwell were seeded into96well plates an equal volume of supernatant supernatantfrom microspheres of 7 d identical as for section 2', '11or bevacizumab vegf inhibitor positive control were alsoadded into 96well plates', ' after 10 h incubation five areaswere randomly selected for each group to photograph with aninverted microscope dmi 8 leica wetzlar germany at 100times magnification', ' the numbers of endothelial tubes in fivedifferent regions were analyzed with imagej software version1', '48v and angiogenesis analyzer plugin for imagej andits average value was applied to calculate tubule formationrate', '2', '13', 'in vivo pharmacokinetics studiesadult new zealand white male rabbits weighing1', '92', '3 kgwere introduced here', ' under the xray digital subtractionangiography xray dsa uniq fd10 philips amsterdannetherlands imaging the rabbits received hepatic arterycatheterization via femoral artery', ' after the successof catheter placement miriplatin 15 mgkg plus regoplease cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001jid ajpsarticle in pressm7may 23 2020235asian journal of pharmaceutical sciences xxx xxxx xxxmicrospheres 50 mgkg with 2 ml iodized oil were infusedand then the catheter was withdrawn', ' at predetermined timeintervals 1 h 4 h 8 h 12 h 1 d 2 d 4 d 6 d 8 d 10 d 12 d 16d 20 d 25 d and 30 d 0', '5 ml blood samples were collectedfrom rabbit auricular vein', ' all the blood samples werecentrifuged to extract the plasma and stored at 80 c untilanalysis', 'rego concentrations were measured by lcms acquityuplcxevo tqs waters milford ma usa', ' 50 μl acetonitrilecontaining 135 ngml sorafenib internal standard waspipetted into a polypropylene tube that contained 100 μl ofplasma and 850 μl of acetonitrile were added', ' after 3 minvortexing followed by 5 min centrifugation at 12 000 rpm thesupernatant was analyzed by using uplcms system on awaters beh c18 column 100 mm  2', '1 mm 1', '7 μm with thecolumn temperature of 35 c', ' the isocratic mobile phasesconsisted of 0', '02 vv formic acid in watermethanol 2278vv at the flow rate of 0', '2 mlmin', ' the chromatographic runtime was 6 min', 'miriplatin concentrations were measured by platinumpt analysis using icpms x series 2 thermo scientificwaltham ma usa in standard instrument operation mode', 'the commentated tune solution was used to optimize theinstrument parameter', ' the major isotope of platinum ptwas determined at mz of 195 meanwhile internal standardelement indium in was determined at mz 115', ' an aliquotof 0', '2 ml rabbit plasma was added into a perfluoralkoxy pfavessel 25 ml adding 1', '5 ml of hno3 65 and 0', '5 ml ofhcl 37', ' then the microwaveassisted acid digestion wasperformed using a microwave mars 6 cem matthews ncusa', ' prior to icpms analysis the sample solutions werediluted to 10 ml with deionized water', ' the pharmacokineticparameters were calculated from the average rego andmiriplatin pt concentrations in the bloodstream usingkinetic 4', '4', '1', '2', '14', 'in vivo evaluation in a hepg2 xenograft tumor modela hepg2 xenograft tumor model was established in femalebalbc nude mice which was applied to determine the in vivoantitumor activity of rego microspheres andor miriplatin', 'female balbc mice 45 weeks old were implanted atthe right armpit by subcutaneous injection with hepg2tumor cells 3  106 0', '2 ml pbs', ' when tumor size wasapprox', ' 150200 mm3  24 balbc mice were randomizedinto 4 groups of 6 animals each', ' subsequently animals infour groups were treated with blank microspheres control200 mgkg rego microspheres 200 mgkg miriplatin alone25 mgkg and rego microspheres 200 mgkg plus miriplatin25 mgkg respectively', ' in four groups mice were treated byintratumorally injection with samples suspended in 100 μliodized oil which were used immediately after preparation', 'animal weights were recorded during the experiments', ' tumorlength l width w were measured and tumor volume tvwas calculated as tv12  l  w2 ', ' after 17 d of observationanimals were sacrificed and then the tumor tissues wereexcised and weighed', ' tumor growth inhibition was definedas the ratio of mean tumor volume of treated groupcompared with control group at the time of sacrifice of themice', '2', '15', '5data analysisthe data analysis of different groups was conducted with oneway anova in graphpad prism 5 software', ' the significantlevel were considered at p  0', '05 and greatly significant at p 0', '001', ' all data are presented as mean  sd', ' unless otherwisestated n  33', 'results and discussion3', '1', 'determination of rego solubility in organic solventsrclinically nonbiodegradable microspheres e', 'g', ' dc beadstmand hepasphere  have been widely used in tace forhcc treatment', ' however since poor water solubilityrego cannot be readily loaded into the microspheresby ion exchange', ' to deliver the hydrophobic drug regomicrospheres were developed via the oil in water owemulsionsolvent evaporation a commonly used methodfor microencapsulating of hydrophobic drugs', ' herein plgawas introduced for microsphere fabrication firstly whichdissolved along with drug in the organic phase', ' thus it isessential to determine rego solubility in various solvents e', 'g', 'dcm ea ac and dmf potentially applicable for microspherepreparation', ' we measured rego solubility of these solventsand found that the values of rego solubility was 2', '71  0', '0615', '16  0', '17 32', '63  0', '26 and 410', '34  2', '65 mgml in dcmea ac and dmf at 25 c respectively', ' according to thedescription of solubility in the united states pharmacopoeiausp rego is only slightly soluble in dcm one of themost desirable solvents in ow emulsion method sparinglysoluble in ea and ac but freely soluble in dmf', ' due to lowsolubility of rego in dcm ea and ac and undesirable formicrosphere preparation watermiscible dmf single solventis not suitable for preparing regoplga microspheres', 'alternatively a cosolvent system may be added to dcm forpreparation of regoplga microspheres and as reportedsolvents of ea ac and dmf have been proposed as cosolvent2830', '3', '2', 'preparation of rego microspheres using variousorganic solventsas described above single solvent is not appropriate forfabricating the microspheres', ' for example the lc ofregoplga microspheres prepared using dcm alone wasonly 2', '1', ' for the development of rego microspheres withhigh loading efficiency we tested ea ac and dmf as cosolventwith dcm', ' as results shown in table 1 when ec ac and dmfwere used as cosolvent with dcm the lc of microspheresincreased to 3', '7 7', '3 and 28', '6 respectively', 'the le of the microspheres prepared by ea and acas cosolvent of dcm was 57', '5 and 48', '4 respectivelywhich was significantly lower than that of the microspheresprepared by dcm single solvent 83', '6', ' in comparison lefor that of the microspheres obtained from dmf as cosolventwith dcm was 91', '5', ' as the capacity for dissolution ofpolymer and drug the characteristics including interfacialtension of solvent solubility of solvent in water and viscosityplease cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001jid ajps6article in pressm7may 23 2020235asian journal of pharmaceutical sciences xxx xxxx xxxfig', ' 1  sem images of rego microspheres in various ratios of dmfdcm', ' a and b for dmfdcm 19 c and d fordmfdcm 14 e and f for dmfdcm 37', ' a c e is 800 b d f is 140', 'need to be further considered appendix 5153 since theyusually affect the le and particle size of the microspheres', 'in this study the insolubility in water and higher solubilityin organic phase of rego were beneficial to improving leof microspheres', ' we also found that the high interfacialtension of organic solvent is desirable in terms of improvingthe le of microspheres meanwhile with the increase ofthe interfacial tension the particle size of microspheresincreased correspondingly similar to previous reports 3132', 'in addition the solubility of solvent in water may alsoinfluence le of microspheres 33', ' last but not the leastthe le difference of microspheres obtained from ac anddmf might be due to not only the balance between the twofactors mentioned above but also the viscosity of the polymersolution', ' the higher viscosity 0', '802 cp of dmf compared tothat 0', '316 cp of ac might also contribute to the enhancementof le in microspheres', 'the optimal microspheres formulation should possessreasonably high lc and le', ' for instance multiple hydrophobicdrugloaded polymeric microspheres have been reported fortace treatment with cisplatin lc of 2', '4 for poly dllacticacid microspheres in dcm 20 sorafenib lc of 15', '7 for polydllactic acid microspheres in dimethyl sulphoxide plusdcm 20 and sorafenib lc of 18', '6 for plga microspheresin dimethyl sulphoxide plus dcm 24', ' in contrast to theprevious studies the obtained rego microspheres couldachieve high lc 28', '6 and le 91', '5 by using the desireddmfdcm cosolvent system', ' it was a common opinion thatmicrospheres with diameters ranging from 40 to 1000 μmwould be desirable 34', ' the average particle size of 149 μmfor the prepared microspheres was suitable for tace', ' fromthe results described above it is observed that dmf ascosolvent with dcm gave appropriate characterizations of lcle and particle size in microsphere formulation', ' it is worth tomention that plga microspheres via using cosolvent systemcould also be applied as platforms to deliver poorly watersoluble potent but costly drugs e', 'g', ' sorafenib cisplatin andpaclitaxel', '3', '3', 'rego microspheres preparation in various ratios ofdmfdcm3', '3', '1', ' rego microspheres preparation in various ratios ofdmfdcmcollectively the preparation of rego microspheres via usingdmfdcm is the optimal cosolvent system', ' the difficultystill remained whether the ratios of dmf and dcm wouldaffect the performance of rego microspheres including lcle particle size surface morphology and release profiles invitro', ' accordingly the ratios of dmf and dcm were selectedat 19 14 or 37 to prepare rego microspheres and theeffects of ratios of dmf and dcm on microspheres werefurther examined', ' as shown in table 2 the particle size ofmicrospheres was 149 170 and 200 μm respectively increasedwith the augment of the dmf proportion', ' as discussed abovethe augment of dmf proportion might increase interfacialtension of mixed solvents accordingly cause the increaseof particle size of the microspheres', ' the lc and le of themicrospheres were 27', '929', '6 and 87', '191', '5 withoutsignificant differences while changing the proportion of dmf', '3', '3', '2', ' morphology of rego microspheres in various ratios ofdmfdcmby the observation of sem surface morphology of regomicrospheres in various ratios of dmfdcm were shown infig', ' 1', ' with the increase of dmf proportion there were moreand more pits on the surface of microspheres', ' meanwhile thedrug particles also increased accordingly on the surface ofmicrospheres', ' it was speculated that during the microspherepreparation dmf partitions into the aqueous phase resultedplease cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001in rego precipitation at the polymerwater interface owingto the poor aqueous solubility of rego', '3', '3', '3', ' in vitro release of rego microspheres in various ratiosof dmfdcmthe solubility of regorafenib in dissolution medium at 37 cwas 26', '28 μgml which was measured reference to themethod described in section 2', '4', ' the release profiles of regofrom the microspheres were illustrated in fig', ' 2', ' even thoughthe microspheres of different formulations gave similar lc itappears that they displayed different release profiles in vitro', 'overall all formulations exhibited biphasic release patternduring 30d period first phase was an initial burst releasesecondary phase was a more sustained release', ' in the first2 d release intervals the microspheres prepared in ratiosof 19 14 37 for dmf and dcm initially released about23', '1 25', '2 and 26', '1 respectively', ' the initial burst releasecould be due to the drug diffused from the particles on thesurface of microspheres', ' and in our case rego microspheressurface may contain high amount of drug particles due tohigher drugloading which might promote the occurrenceof burst release 35', ' recent studies have demonstrated thatpatient serumplasma vegf levels increased significantlywithin the first 24 h after tace suggesting an undesirableneoangiogenetic reaction 3637', ' as we developed regoloaded plga microspheres to limit proangiogenic responsesfor tace the initial burst of rego might be beneficial forclinical application to synchronize with and act on the first24 h rising of vegf levels', ' at 30 d the release percentage ofrego from the microspheres prepared in ratios of 19 14 37for dmf and dcm were 70', '8 57', '6 and 51', '2 respectively', 'the 30day release decreased with the increase of dmf ratioand the lower release of rego might be explained by theincrease of particle size of the microspheres', ' the differentrelease behaviors of the obtained microspheres were affectedby their physicochemical properties such as morphologyparticle size and drug loading', ' like process parametersmultiple competing factors such as solubility of drug in theorganic phase interfacial tension between solvent cosolventand water the viscosity of the polymer phase and solubilityof solvent in water could also affect the aforementionedfig', ' 3  infrared spectra of a blank microspheres b regoc physical mixture of blank microspheres and rego andd rego microspheres', 'physicochemical properties', ' this certainly increased thecomplexity of drug release meanwhile provided numerouspossible ways to fulfill the adjustable release 3839', ' thedrug release profile would indeed offer more treatmentoptions for tace therapy', ' collectively the microspheresprovided a platform to better adjust the loading of thedrugs particle size and the release pattern which couldmeet the requirements of various drug delivery systems', 'the dissolution pattern of the formulation in ratios of 19for dmf and dcm was optimal for the desired highest30d sustained release in our study', ' in the subsequentexperiments we chose the microspheres prepared in ratios of19 for dmf and dcm for further investigation', '3', '4', 'characterization of blank microspheres and regomicrospheresthe morphology of rego microspheres from sem hasconfirmed the successful formation of rego microspheres', 'for further verification we utilized infrared spectra and xraypowder diffraction to characterize the prepared microspheres', 'as shown in fig', ' 3 of ir spectra rego shared characteristicabsorption peaks at 1123 1540 1716 and 3375 cm1 ', ' theseabsorption peaks still existed in the physical mixture ofblank microspheres with rego except for the intensitydecreased', ' as rego microspheres these absorption peaksalmost disappeared', 'as xrd profiles shown in fig', ' 4 rego gave crystaldiffraction peaks in the range of 1035 indicating thatrego existed in the form of crystal', ' similar to ir spectrathese characteristic peaks still presented in the physicalmixture of blank microspheres and rego however theintensity decreased simultaneously', ' it was observed that thecharacteristic peaks for rego in xrd pattern could not befound in rego microspheres', ' the results of ir and xrd imagessuggested that rego were embedded in the skeleton of plgamicrospheres and did not exist in a mixed form', 'please cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '0013', '5', 'effect of rego on drug resistance of hepg2 inducedby miriplatinin our study we introduced injectable miriplatin aschemotherapeutic drug for tace', ' considering that thecytotoxic chemotherapeutics are susceptible to drugresistance in the treatment of hcc we introducedrego for the remedy', ' in previous studies rego couldantagonistic the resistance of paclitaxel associated withabcb1 transporter on colorectal tumors in mice 40', ' wedetermined the cytotoxicity of miriplatin on hepg2 cellsand the resistant cell lines and the effect of rego onthe resistant cell lines induced by miriplatin was furtherevaluated', ' the ic50 values of miriplatin and the resistanceindex of resistant cell lines were summarized in table 3', 'hepg2mirirego 0 cell displayed resistance to miriplatinwith ic50 of 30', '08  0', '27 μgml as well as the resistanceindex of 13', '61 as compared to hepg2 cells', ' upon regoaction in the process of establishing drugresistant cellsthe sensitivity of the drug resistant cell hepg2mirirego 0', '5 hepg2mirirego 1', '0 hepg2mirirego 2', '0to miriplatin was enhanced and evidenced by greatlysignificant decrease in ic50 values p  0', '001 of 14', '43  0', '2712', '80  0', '47 and 6', '43  0', '32 μgml respectively', ' meanwhilethe resistance index was also decreasing as 6', '53 5', '79 and 2', '91respectively', 'as demonstrated in fig', ' 5 the ic50 values were reducedwith the increase of rego concentration during inductionresulting in a leftward shift of the concentrationresponsecurve', ' in the present study rego performed intensive effectson reversing drug resistance of hepg2 cells in vitro', ' theseresults demonstrated the potentiation of the anticancereffects of miriplatin in drug resistant cells by rego suggestingthe concept that rego microspheres might perform thepotential of antagonizing miriplatin resistance continuouslywhen coadministered in clinical tace', '3', '6', 'in vitro cytotoxicity studiesthe above results of rego function on the resistant cell linesindicated that rego could increase the sensitivity of hepg2cells to miriplatin', ' the in vitro biological activity in groupsof blank microspheres rego microspheres miriplatin andrego microspheres plus miriplatin were further assessedfor cytotoxicity', ' the viability of hepg2 cells with variouspreparations were shown in fig', ' 6', ' supernatants from blankmicrospheres were noncytotoxic and adopted as control', ' itwas found that supernatants from rego microspheres andplease cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001fig', ' 6  cytotoxic effects of sample supernatants obtainedfor different incubation time 1 d 3 d or 7 d on hepg2 cellviability', ' data are expressed as the means  sd n  5', '  p 0', '05 compared with control  p  0', '05 between conditions', 'miriplatin alone or in combination significantly inhibited cellproliferation compared to the control group at the indicatedtime points fig', ' 6', ' interestingly it exhibited significantinhibition of the combinatorial group compared to themonotherapy for different incubated time 1 d 3 d or 7 d', 'it is worth noting that with the increase of incubation timethe inhibitory effect of the combinatorial group was moreremarkable', ' the cell viability of hepg2 in the combinatorialgroup for one dayincubation was 31', '2 compared to themiriplatin monotherapy group of 41', '4 while that for 7dincubation was only 8', '2 compared to the miriplatinmonotherapy group of 30', '4', 'the superior efficacy in combinatorial treatment groupcould inhibit or block the related factors of cell proliferationand survival with different mechanisms of action', ' moreoverthe outstanding functions of rego might contributeto the decrease of the drug resistance of hepg2 cellsinduced by miriplatin', ' accordingly rego could obtainthe similar therapeutic outcomes in combination withother conventional chemotherapeutic agents', ' synergisticantitumor effects were observed with the addition of rego to5fluorouracil in multiple human colorectal cancer cell lines41', ' in another study it was found that rego potentiatedantitumor effect of topotecan in the mitoxantroneresistantxenograft model 42', ' the results presented in fig', ' 6 indicatedthat rego microspheres could continuously enhancemiriplatin cytotoxic activity in vitro and might be effectivelyapplied in tace together with miriplatin', '3', '7', 'in vitro huvecs tubeformation assayfrom above in vitro cytotoxicity studies rego microsphereshave demonstrated the inhibition of tumor cell proliferation', 'in order to evaluate the antiangiogenesis effect of regomicrospheres huvecs tube formation assay was performedin different samples for 7 d incubation in which vegfinhibitor bevacizumab as positive control', ' as shown in3', '8', 'in vivo pharmacokinetics studyto further confirm the sustained release of rego from themicrospheres in vivo plasma levels of miriplatin pt andrego measured at predetermined time points after tacewere shown in fig', ' 8', ' plasma concentrations of miriplatinpt decreased slowly and the concentration was still at192', '8 ngml after 30 d that was approximately half of cmax395', '2 ngml', ' meanwhile plasma concentrations of regodecreased slowly of which the concentration was maintainedat 1', '0 ngml until 30 d approximately 25 of cmax 2', '5 ngml', 'as listed in table 4 the plasma elimination halflife t12  formiriplatin pt and rego was 607', '9 h and 576', '8 h respectively', 'the results revealed that rego could be released frommicrospheres sustainably for more than 30 d in vivo', ' thissustained release kinetics in vivo might potentiate therapeuticeffects continuously after tace as we proposed', '3', '9', 'modelin vivo antitumor efficacy in hepg2 xenograft tumorconsidering the promising in vitro biological activity anddesirable pk profiles the in vivo pharmacological efficacywas further investigated in a hepg2 xenograft tumor model', 'in the experimental process body weight of animals in eachgroup was stable', ' it suggested that the experimental doses inall groups were tolerable', ' as shown in fig', ' 9a we found anobvious retardation of tumor growth for animals treated withrego microspheres miriplatin alone or in combination ascompared to the control group', ' most importantly treatmentwith the combination of rego microspheres and miriplatincould significantly enhance the efficacy of chemotherapyfor miriplatin alone as evidenced by more remarkableslowdown for tumor growth in relative to the miriplatinplease cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001monotherapy group p  0', '05', ' on day 17 animals in blankmicrospheres group performed a high average tumor weightof 1', '62 g fig', ' 9b', ' the animals treated with miriplatin alonerego microspheres and in combination exhibited lowermean tumor weight of 0', '70 g 0', '56 g and 0', '48 g respectively', 'a significantly lower mean tumor weight was obvious formiriplatin plus rego microspheres compared to miriplatinalone p  0', '05', 'the results in fig', ' 9 supported our design that the localsustained release of antiangiogenic rego from microspherescould potentiate the anticancer efficacy of chemotherapeuticmiriplatin in hepg2 xenograft tumor model', ' there werepromising therapeutic effects of locally delivering antiangiogenic rego with tace for treatment of liver cancers', 'the improved therapeutic effects generated from regomicrospheres could result from the mechanism of action ofrego in treatment', ' as detection the tumor cell proliferationwas inhibited by rego similar to other chemotherapeuticdrugs', ' this was suggested in fig', ' 6 regarding in vitrocytotoxic effect of rego released from microsphereson hepg2 cells', ' moreover rego could also suppressmultiple protein kinases such as stromal and angiogenickinases vegfr tie2 pdgfrβ and fgfr tumorigenickinases kit ret raf1 braf and mutant braf', ' thesekinases could promote tumor neovascularization vesselstabilization and lymphatic vessel formation and thus playan important role in tumor microenvironment which wascontributed to tumor deterioration and metastasis 134344', 'therefore rego could suppress the angiogenesis by reducingassociated protein kinases induced by tace', ' indeed theantiangiogenic effect of rego mediated by microsphereshave been demonstrated in fig', ' 7', ' moreover the effects ofregomediated normalization of the tumor vasculaturemight elevate the efficacy of miriplatin monotherapy', 'previous study demonstrated that rego could normalizethe tumor vasculature when combined with irinotecanin oxaliplatinrefractory patientderived colorectal cancerxenografts and the combination significantly delayedplease cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001jid ajpsarticle in pressasian journal of pharmaceutical sciences xxx xxxx xxxm7may 23 202023511fig', ' 9  antitumor activity of rego microspheres and miriplatin alone or combination in balbc mice bearing hepg2 cells', 'a tumor growth curves for each group', ' b tumor weight measured on day 17 after the experiment', ' c the images ofexcised tumors in mice collected after sacrifice', ' data are expressed as the means  sd n  6', '  p  0', '05 compared withcontrol  p  0', '05 compared with miriplatin alone', 'tumor growth 45', ' as mentioned in a previous reportantiangiogenic agents with tumor normalizing potentialhave also documented antitumor activity against hcc 46', 'last but not least rego could reduce the drug resistance ofhepg2 induced by miriplatin as demonstrated in our in vitroinvestigation fig', ' 5', ' numerous studies have shown that regowould antagonize drug resistance and provide an improvedtreatment efficacy combined with chemotherapy 404247', '3', '10', 'outlookthe regoloaded plga microspheres provide morepossibilities in adjusting drug loading particle size anddrug release', ' when altering plga type molecular weightthe ration of lactic to glycolic acid formulation compositionand preparation process we could finetune the abovecharacterizations for clinical application which is especiallymeaningful for tace treatment', ' as a result of the numerousfactors for the therapeutic effect of tace such as tumorburden liver functions and response to previous treatmentsthere was not any standardized protocol in tace includingchemotherapeutic drugs dosage injection rate time intervalbetween treatments and etc', ' 234', ' in our study plgamicrospheres was able to carry multiple chemotherapeuticdrugs or drug combinations with adjustable drug loadingparticle size and drug release profiles thus as a platformtechnology useful for tace personalized therapy', 'withthedevelopmentofmoleculartargetedantiangiogenic therapy and recent advances in understandinghcc pathophysiology the novel targeted combinationstrategies are emerging', ' the rego microspheres prepared fortace in this study have performed the promising benefits toimproving the effects of tace and could be a novel therapyregiment for tace', ' in addition to antiangiogenic effects regoshared a certain cytotoxic efficacy and mediated capacityof normalization of the tumor vasculature and potentialto overcome drug resistance of chemotherapy which wascontributed to the increased therapeutic potency of tace', ' dueto the complexity of hcc treatment including tace balancebetween the therapeutic effect and unexpected stimulationof tumor angiogenesis the optimal dose and regimen of regoin combination with tace needs to be extensively exploredfurther', 'in the present study our preliminary in vivo results viaadopting simpler administration in mice were promisingto prove the concept of novel treatment strategy howeverit is worthy further in vivo study', ' in this regard regomicrospheres will be administrated via tace into animalsbearing liver tumor', ' for example rabbit vx2 liver tumor modelwhich is a common animal model for evaluating therapeuticsafety and effect in tace 4850 may be adopted in futurestudies including pharmacokinetics and antitumor effects ifresources allow', '4', 'conclusionsin this study plga microspheres has been introducedto incorporate an orally multikinase inhibitor rego', ' thefabricated rego microspheres provided sustained drugrelease for more than 30 d in vitro and in vivo after tace', 'the microspheres demonstrated enhanced cytotoxic effectsof miriplatin on hepg2 cells in vitro', ' more interestinglyan intense antiangiogenic effect and the potential ofantagonizing chemotherapeutic miriplatin resistance wereobserved in vitro', ' moreover in vivo investigation in ahepg2 xenograft tumor model demonstrated the outstandingantitumor efficacy of rego microspheres significantly insuperior to miriplatin monotherapy', ' in summary the resultsof this study demonstrated that rego microspheres forlocal delivery as a novel combination strategy with tacemay enhance the therapeutic potency of tace for thetreatment of hcc and has promising clinical implications infuture', 'please cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001article in pressjid ajps12m7may 23 2020235asian journal of pharmaceutical sciences xxx xxxx xxxdeclaration of competing interest10the authors report no conflicts of interest in this work', '', '', 'the authors gratefully acknowledge the national naturalscience foundation of china 81872819 and 81573379natural science foundation of jiangsu province bk20171390', 'this study was also supported by double firstclassuniversity project cpu2018gy26 the project of state keylaboratory of natural medicines china pharmaceuticaluniversity sklnmzzcx201816 and the financial supportfrom development funds for priority academic programs injiangsu higher education institutions', ' the authors finallythank public platform of state key laboratory of naturalmedicines for assistance with scanning electron microscopy', 'supplementary materialssupplementary material associated with this article can befound in the online version at doi10', '1016j', 'ajps', '2020', '01', '001', '', '1 rahbari nn arianeb m mollberg nm müller sa moritz kbüchler mw et al', ' hepatocellular carcinoma currentmanagement and perspectives for the future', ' ann surg20112533453', '2 lau wy yu sc lai ec leung tw', ' transarterialchemoembolization for hepatocellular carcinoma', ' j am collsurg 2006202115568', '3 fuchs k duran r denys a bize pe borchard g jordan o', 'drugeluting embolic microspheres for local drugdeliverystate of the art', ' j control release 201726212738', '4 poursaid a jensen mm huo e ghandehari h', ' polymericmaterials for embolic and chemoembolic applications', ' jcontrol release 201624041433', '5 wang b xu h gao zq ning hf sun yq cao gw', ' increasedexpression of vascular endothelial growth factor inhepatocellular carcinoma after transcatheter arterialchemoembolization', ' acta radiol 20084955239', '6 ranieri g ammendola m marech i laterza a abbate ioakley c et al', ' vascular endothelial growth factor andtryptase changes after chemoembolization inhepatocarcinoma patients', ' world j gastroenterol201521196018', '7 hyun sj joongwon p hoon kj min a sunyoung kbyungho n et al', ' association between increment of serumvegf level and prognosis after transcatheter arterialchemoembolization in hepatocellular carcinoma patients', 'cancer sci 20089910203744', '8 varghese j kedarisetty c venkataraman j srinivasan vdeepashree t uthappa m et al', ' combination of tace andsorafenib improves outcomes in bclc stages bc ofhepatocellular carcinoma a single centre experience', ' annhepatol 201716224754', '9 pawlik tm reyes dk david c kamel ir nikhil bgeschwind jfh', ' phase ii trial of sorafenib combined withconcurrent transarterial chemoembolization withdrugeluting beads for hepatocellular carcinoma', ' j clinoncol 2011293039607', 'park jw koh yh kim hb kim hy an s choi ji et al', ' phaseii study of concurrent transarterial chemoembolization andsorafenib in patients with unresectable hepatocellularcarcinoma', ' j hepatol 2012566133642', 'masatoshi k kazuho i nobuyuki c kohei n wonyoung ttadatoshi t et al', ' phase iii study of sorafenib aftertransarterial chemoembolisation in japanese and koreanpatients with unresectable hepatocellular carcinoma', ' eur jcancer 20114714211727', 'lencioni r llovet jm han g tak wy yang j guglielmi aet al', ' sorafenib or placebo plus tace withdoxorubicineluting beads for intermediate stage hcc thespace trial', ' j hepatol 201664510908', 'wilhelm sm jacques d lila a mark l carter ca gunnar set al', ' regorafenib bay 734506 a new oral multikinaseinhibitor of angiogenic stromal and oncogenic receptortyrosine kinases with potent preclinical antitumor activity', 'int j cancer 2011129124555', 'dirk s beate s', ' regorafenib for cancer', ' expert opin investigdrugs 201221687989', 'demetri gd reichardt p kang yk blay jy rutkowski pgelderblom h et al', ' efficacy and safety of regorafenib foradvanced gastrointestinal stromal tumours after failure ofimatinib and sunitinib grid an international multicentrerandomised placebocontrolled phase 3 trial', ' lancet20133819863295302', 'grothey a cutsem ev sobrero a siena s falcone aychou m et al', ' regorafenib monotherapy for previouslytreated metastatic colorectal cancer correct aninternational multicentre randomised placebocontrolledphase 3 trial', ' lancet 2013381986330312', 'rimassa l pressiani t personeni n santoro a', ' regorafenibfor the treatment of unresectable hepatocellular carcinoma', 'expert rev anticancer ther 201717756776', 'c damiano g girolamo r', ' transarterial chemoembolizationas a therapy for liver tumours new clinical developmentsand suggestions for combination with angiogenesisinhibitors', ' crit rev oncol hematol 20118014053', 'ramazani f chen w nostrum cf van storm g kiessling flammers t et al', ' formulation and characterization ofmicrospheres loaded with imatinib for sustained delivery', 'int j pharm 20154821212330', 'wang y molin dg sevrin c grandfils c nm vdagagliardi m et al', ' in vitro and in vivo evaluation ofdrugeluting microspheres designed for transarterialchemoembolization therapy', ' int j pharm20165031215062', 'christian w schwendeman sp', ' principles of encapsulatinghydrophobic drugs in plaplga microparticles', ' int j pharm20083642298327', 'jain ra', ' the manufacturing techniques of various drugloaded biodegradable polylactidecoglycolide plgadevices', ' biomaterials 20002123247590', 'jin wc park jh song yb kim dd kim hc cho hj', 'doxorubicinloaded polylacticcoglycolic acidmicrospheres prepared using the solidinoilinwatermethod for the transarterial chemoembolization of a livertumor', ' colloids surfaces b biointerfaces 201513230512', 'jeane c sheu ay weiguo l zhuoli z donghyun klewandowski rj et al', ' polylactidecoglycolidemicrospheres for mrimonitored transcatheter delivery ofsorafenib to liver tumors', ' j control release 201418411017', 'yanai s okada h saito k kuge y misaki m ogawa yet al', ' optimal formulation of an angiogenesis inhibitortnp470 for arterial injection determined by in vitro drugrelease and stability and in vivo antitumor activity', ' int jpharm 1995123223745', 'please cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001jid ajpsarticle in pressasian journal of pharmaceutical sciences xxx xxxx xxx26 hanada m baba a tsutsumishita y noguchi t yamaoka tchiba n et al', ' intrahepatic arterial administration withmiriplatin suspended in an oily lymphographic agentinhibits the growth of tumors implanted in rat livers byinducing platinumdna adducts to form and massiveapoptosis', ' cancer chemother pharmacol 200964347383', '27 takuji o hiroshi k hiroshi i masatoshi k michio skatsuaki t et al', ' a randomized phase ii trial of intraarterialchemotherapy using sm11355 miriplatin for hepatocellularcarcinoma', ' invest new drugs 2012305201525', '28 graves ra thomas f sarala p natalie p raisa m mandal tk', 'effect of cosolvents on the characteristics of enkephalinmicrocapsules', ' j biomater sci polym ed 200617670920', '29 shenderova a burke tg schwendeman sp', ' stabilization of10hydroxycamptothecin in polylactidecoglycolidemicrosphere delivery vehicles', ' pharm res19971410140614', '30 jing wf hwa wc', ' sustained release of etanidazole fromspray dried microspheres prepared by nonhalogenatedsolvents', ' j control release 200281326380', '31 itoabc f honnami h kawakami h kanamura k makino k', 'study of types and mixture ratio of organic solvent used todissolve polymers for preparation of drugcontaining plgamicrospheres', ' eur polym j 200945365867', '32 rawat a burgess dj', ' effect of ethanol as a processingcosolvent on the plga microsphere characteristics', ' int jpharm 2010394199105', '33 sah h', ' microencapsulation techniques using ethyl acetate asa dispersed solvent effects of its extraction rate on thecharacteristics of plga microspheres', ' j control release199747323345', '34 giunchedi p maestri m gavini e dionigi p rassu g', 'transarterial chemoembolization of hepatocellularcarcinoma  agents and drugsan overview', ' part 2', ' expertopin drug deliv 2013106799810', '35 wang j wang bm schwendeman sp', ' characterization of theinitial burst release of a model peptide from polydllactidecoglycolide microspheres', ' j control release2002822289307', '36 hyun sj joongwon p hoon kj min a sunyoung kbyungho n et al', ' association between increment of serumvegf level and prognosis after transcatheter arterialchemoembolization in hepatocellular carcinoma patients', 'cancer sci 20109910203744', '37 li x feng gs zheng cs zhuo ck liu x', ' expression ofplasma vascular endothelial growth factor in patients withhepatocellular carcinoma and effect of transcatheter arterialchemoembolization therapy on plasma vascular endothelialgrowth factor level', ' world j gastroenterol20041019287882', '38 zhang h gao s', ' temozolomideplga microparticles andantitumor activity against glioma c6 cancer cells in vitro', ' int jpharm 2007329121228', '39 fredenberg s wahlgren m reslow m axelsson a', ' themechanisms of drug release in polylacticcoglycolicacidbased drug delivery systemsa review', ' int j pharm2011415123452', 'm7may 23 20202351340 wang yj zhang yk zhang gn rihani sba wei mn gupta pet al', ' regorafenib overcomes chemotherapeutic multidrugresistance mediated by abcb1 transporter in colorectalcancer in vitro and in vivo study', ' cancer lett 201739614554', '41 marks ei tan c zhang j zhou l yang z scicchitano aet al', ' regorafenib with a fluoropyrimidine for metastaticcolorectal cancer after progression on multiple5fucontaining combination therapies and regorafenibmonotherapy', ' cancer biol ther 20151612171019', '42 zhang yk wang yj lei zn zhang gn zhang xy wang dset al', ' regorafenib antagonizes bcrpmediated multidrugresistance in colon cancer', ' cancer lett 201944210412', '43 zopf d fichtner i bhargava a steinke w thierauch khdiefenbach k et al', ' pharmacologic activity andpharmacokinetics of metabolites of regorafenib inpreclinical models', ' cancer med 2016511317685', '44 thillai k srikandarajah k ross p', ' regorafenib as treatmentfor patients with advanced hepatocellular cancer', ' futureoncol 20171325222332', '45 roberta s jens h michael b ajay b tina m nicole ket al', ' regorafenib bay 734506 antitumor andantimetastatic activities in preclinical models of colorectalcancer', ' int j cancer 20141356148796', '46 liu k zhang x xu w chen j yu j gamble jr et al', ' targetingthe vasculature in hepatocellular carcinoma treatmentstarving versus normalizing blood supply', ' clin translgastroenterol 201786e98', '47 cai mh xu xg yan sl sun z ying y wang bket al', ' regorafenib suppresses colon tumorigenesis and thegeneration of drug resistant cancer stemlike cells viamodulation of mir34a associated signaling', ' j exp clincancer res 2018371151', '48 liang yj yu h feng g zhuang l xi w ma met al', ' highperformance plgamagnetic microspheresprepared by rotating membrane emulsification fortranscatheter arterial embolization and magnetic ablation invx2 liver tumors', ' acs appl mate interfaces20179504347889', '49 kim gm kim md kim dy kim sh won jy park siet al', ' transarterial chemoembolization using sorafenib in arabbit vx2 liver tumor model pharmacokinetics andantitumor effect', ' j vasc interv radiol 2016277108692', '50 lee kh liapi e ventura vp buijs m vossen ja vali mgeschwind jf', ' evaluation of different calibrated sphericalpolyvinyl alcohol microspheres in transcatheter arterialchemoembolization vx2 tumor model in rabbit liver', ' j vascinterv radiol 200819710659', '51 rowell rl', ' physical chemistry of surfaces 6th ed', ' j colloidinterface sci 19982082582', '52 smallwood im', ' handbook of organic solvent properties', 'oxford butterworthheinemann 2012', '53 sah h', ' protein behavior at the watermethylene chlorideinterface', ' j pharm sci 2010881213205', 'please cite this article as xiang li guangwei he and feng su et al', ' regorafenibloaded poly lactidecoglycolide microspheresdesigned to improve transarterial chemoembolization therapy for hepatocellular carcinoma asian journal of pharmaceuticalsciences httpsdoi', 'org10', '1016j', 'ajps', '2020', '01', '001', ''], 'The Effect Of Pramlintide, An Antidiabetic Amylin Analogue On Angiogenesis Related Markers In Vitro': ['', 'background and purpose irregularities of angiogenesis may participate in the pathogenesis of diabetescomplications', ' pramlintide is an amylin analogue administered for the treatment of type 1 and type 2 diabetes', 'the present investigation aimed at surveying the effect of pramlintide on angiogenesisrelated markers inhuman umbilical vein endothelial cells huvecs', 'experimental approach the proliferation of cells was assessed using 345dimethylthiazol2yl25diphenyltetrazolium bromide mtt method', ' the effect of pramlintide on migration was estimated bytranswell assay', ' in vitro evaluation of angiogenesis was performed by tube formation assay', ' the secretionof vascular endothelial growth factor vegf to the supernatant of huvecs was measured by an enzymelinked immunosorbent assay elisa kit', ' all experiments were performed in triplicate', 'findings  results pramlintide exhibited no inhibitory effect on huvecs proliferation', ' it significantlyincreased cell migration at the concentration of 1 µgml', ' pramlintide 1 µgml also enhanced average tubuleslength size and the mean number of junctions', ' however there was not any significant change in vegf releasefrom huvecs', 'conclusion and implications findings of this research revealed the effect of pramlintide on angiogenesisrelated markers via enhancing migration and tubulogenesis in vitro suggesting a worthwhile proposition forfurther clinical researches on improving vascular complications and healing of diabetic wounds', '', 'angiogenesis cell migration diabetes mellitus huvec pramlintide vegf', '', 'diabetes mellitus is a complicated endocrinedisorder and the fourth leading cause of deathin the world', ' this common health problemaffects about 422 million persons 8', '5 of theadult population worldwide and its prevalenceis estimated to increase to 642 million in thenext 25 years 12', ' vascular complications ofdiabetes are important reasons for mortality andmorbidity in diabetic patients 3', ' endothelialdysfunction and impaired angiogenesis areconsidered as the main pathological features ofdiabetic vascular problems 4', ' angiogenesisrefers to the development of new blood vesselscorresponding author l', ' safaeianfrom preexisting vessels 5', ' this processoccurs during some normal and pathologicalconditions through a series of organized stages', 'during angiogenesis various regulating factorsare involved in the stimulation of endothelialcells degradation of the capillary basementmembrane capillary sprouting migration tubeformation and finally in maturation andstabilization of the new vessel 6', ' diabetes isassociated with abnormal angiogenesis in atissuespecific manner', '', 'enhanced angiogenesis is a mainpathologicalcharacteristicindiabeticretinopathyandreducedangiogenesiscontributes to the impaired wound healingperipheral artery diseases and various ischemicconditions 7', 'pramlintideisaninjectableantihyperglycemic drug approved for thetreatment of types 1 and 2 diabetic patients whotake insulin and do not reach the desiredglucose levels 8', ' it regulates blood glucoselevels through slowing gastric emptyingstimulating satiety and decreasing secretion ofglucagon', ' pramlintide is a synthetic analog ofhuman amylin and functions as an amylinagonist 9', ' amylin or islet amyloidpolypeptide iapp is a peptide hormone thatacts as a part of the endocrine system of thepancreas in controlling postprandial bloodglucose along with insulin 10', 'amylin indeed belongs to the calcitoningene peptide superfamily whose members arecalcitonin calcitonin generelated peptidecgrp adrenomedullin and amylin withsome similar biological effects due to thesimilarity in their structures and receptors 11', 'there are pieces of evidence that most membersof this superfamily have important effects onangiogenesis', ' adrenomedullin functions as anangiogenic growth factor and inhibits apoptosisin endothelial cells 12', ' calcitonin promotesseveral stages of angiogenesis via a direct effecton endothelial cells and cgrp also stimulatesangiogenesis and facilitates wound healing1314', 'regarding the role of calcitonin superfamilypeptides on angiogenesis and crossreactivitybetween their receptors the aim of this studywas to evaluate the effect of pramlintide as anamylin analog on angiogenesis in humanumbilical vein endothelial cells huvecs', 'iran', ' transwell inserts were obtained fromspl life sciences co', ' ltd', ' gyeonggidokorea', ' geltrex was purchased from gibcobrl life technologies inc', ' californiausa', ' calcein acetoxymethyl dye wasprepared from santa cruz biotechnology inc', 'santa cruz canada', ' recombinant humanvascular endothelial growth factor vegf andthe enzymelinked immunosorbent assayelisa kit for its evaluation were purchasedfrom peprotech inc', ' new jersey usa', 'cell culturehuvecs pasteur institute tehrani', 'r', ' iran were cultured in 75 cm2 flasks indmem supplemented with 10 fbs and 100uml penicillinstreptomycin at 37 c in ahumidified 5 co2 incubator', ' all experimentswere performed in 2 to 4 passages', 'mtt assaythe viability of huvecs was assessedusing the mtt method 15', ' briefly the cellswere seeded at 1  105 cellswell in the 96wellplates', ' after 24 h plating huvecs weretreated with pramlintide at 1 2 5 10 and20 µgml and then incubated for an additional24 h', ' after that mtt reagent 10 μl wasadded and cultivated for 4 h at 37 c', ' theformazan crystals resulting from mtt reactionwith living cells were dissolved in dimethylsulfoxide and absorbance was measured usinga microplate readerspectrophotometer biotek powerwave xs usa at 570 nm', ' thecells without any exposure to pramlintide wereconsidered as control', ' the viability of treatedhuvecs was evaluated by comparison of theabsorbance of each sample with control', ' allexperiments were done in triplicate', 'cell migration assaycell migration was evaluated usingtranswell inserts with 8 μm pore sizes', ' inbrief huvecs were treated with vehicle orpramlintide 1 and 10 µgml or with vegf10 ngml as the standard control for 24 h andthen added to the upper chamber 3  104cellswell', ' the desired chemoattractantgrowth medium supplemented with 20 fbswas placed into the lower chamber', ' after 4 hincubation the media and nonmigrated cellsmaterials and methodschemicalspramlintide was provided by astrazenecaco', ' cambridge uk', ' dulbeccos modifiedeagles medium dmem fetal bovine serumfbs and 345dimethylthiazol2yl25diphenyltetrazolium bromide mtt assay kitwere purchased from bioidea co', ' tehran i', 'r', '324effect of pramlintide on angiogenesiswere removed and migrating cells were fixedwith 70 ethanol and stained with 0', '2 crystalviolet for 10 min', ' the numbers of migratedcells toward the chemoattractant were countedusing an inverted microscope nikoninstruments new york usa 16', 'the supernatants was calculated using astandard curve and expressed in pgml 18', 'statistical analysisdata are presented as the mean  standarderror of the mean sem', ' for statisticalanalysis oneway analysis of varianceanova followed by tukey posthoc test wasdone using spss software version 18', '0', ' thepvalue  0', '05 was considered statisticallysignificant', 'capillary tube formation assayfor evaluation of the effect of pramlintide ontube formation the geltrextm reduced growthfactor basement membrane matrix was used', 'briefly the icecold 24well plates were coatedwith geltrextm 10 ngml and incubated at 37c for 30 min', ' huvecs were plated 1', '2 105well in the absence or presence of thepramlintide 1 and 10 µgml or vegf2 ngml on the polymerized geltrextmsurface layer in dmem', ' after 24 h incubationat 37 c  5 co2 the cells were washed withhanks balanced salt solution and stained withcalcein acetoxymethyl dye', ' photographs ofeach well were taken with a nikon coolpixcamera attached to an inverted fluorescentmicroscope', ' the average tubules length sizeand the mean number of junctions weremeasured in 5 high power fields of each wellusing angioquant software matlab inc', 'tampere finland 17', 'resultseffect of pramlintide on huvecs viabilitythe viability of huvecs was assessed bythe mtt method after 24 h exposure topramlintide', ' treatment with pramlintide at theconcentration range of 120 µgml caused noinhibitory effect on huvecs proliferationfig', ' 1', ' since there were no significantdifferences between various concentrationspramlintide was used at the concentrations of1 and 10 µgml in further studies', 'effect of pramlintide on huvecs migrationthe effect of pramlintide on the migration ofendothelial cells was evaluated by transwellassay', ' as shown in fig', ' 2 administration ofpramlintide at 1 µgml significantly increasedcell migration compared to the control after24 h incubation p  0', '05', ' however this resultwas significantly less than the vegf effectp  0', '05', 'vegf secretion assayvegf concentration was measured insupernatants of treated huvecs by an elisakit according to the protocol provided by themanufacturer', ' the amount of vegf released inngml and pramlintide 1 µgml after 24 htreatment in huvecs figs', ' 4ac', ' thehighest average tubules length size and themean number of junctions were observed invegftreated cells compared to the controlcells p  0', '001', ' pramlintide at 1 µgml alsocaused a significant enhancement in averageeffect of pramlintide on tube formation ofhuvecstube formation assay on geltrextmbasement membrane matrix was used for invitro evaluation of angiogenesis', ' figure 3arepresents the tubular structures in normaluntreated huvecs', ' treatments with vegffig', ' 3b and pramlintide at 1 µgml fig', ' 3cpromoted capillary tube formation compared totubules length andsize and the mean numberof junctions in comparison with normaluntreated huvecs p  0', '001', ' treatmentwith 10 µgml failed to increase theaverage tubules length size and number ofjunctions compared with 1 µgml ofpramlintide p  0', '05', 'effect of pramlintide on vegf secretionthe effect of pramlintide on vegf secretionin the cell culture supernatants was tested usingan elisa kit', ' no significant changes wereobserved after the administration of pramlintidein vegf release into the supernatants ofhuvecs fig', ' 5', 'fig', ' 4', ' effect of pramlintide on capillary tube formation on geltrextm', ' huvecs were seeded on geltrextm and treatedwithout or with pramlintide 1 and 10 µgml or vegf 2 ngml for 24 h', ' quantitation of tube formation was done bycalculating the average a tubules length b tubules size and c mean number of junctions', ' data are shown as means sem from triplicate experiments', ' p  0', '001 indicates significant differences compared to the control group untreatedcells p  0', '01 and p  0', '001 versus vegf group', ' huvecs human umbilical vein endothelial cells vegf vascularendothelial growth factor', 'fig', ' 5', ' effect of pramlintide on vegf secretion in huvecs determined by elisa', ' cells were treated without or withpramlintide 1 and 10 µgml for 24 h and the supernatants were examined for vegf', ' data are shown as means  semfrom triplicate experiments', ' huvecs human umbilical vein endothelial cells vegf vascular endothelial growth factorelisa enzymelinked immunosorbent assayampkendothelial nitric oxide synthaseenos and focal adhesion kinase pathways', 'the effects of cgrp on migration and tubeformation have been equal or more potent thanthat of the vegf effect 14', 'in the present study pramlintide 120µgml had no significant effect on huvecsproliferation though no inhibitory effect on cellviability was observed', ' our results alsorevealed that pramlintide 1 µgml but not 10µgml promoted migration and capillary tubeformation', ' in a recent investigation pramlintidepromoted neurogenesis and prevented themitochondrialdependent apoptosis with anoptimal effect at 250300 nm about 11', '2µgml 22', ' low concentration of a humanamylin fragment 3 μm has also beenassociated with stimulating vegf secretionfrom endothelial cells and preserving thesurvival of neuronlike cells however it hasshown toxic effects on cell proliferation at itshigh concentration 20 µm 23', ' moreoveramylin has been related to vascular damagesdependent on its aggregated form', ' it seems thatthe diverse effects of amylin may be mediatedby various amylin receptors', 'our results showed the activity ofpramlintide on increasing huvecs migrationat 1 µgml which was significantly less thanvegf effect p  0', '05', ' while cgrp 1 nmas a member of amylin superfamily has showna similar effect to that of vegf 20 ngml onhuvecs migration in the study of tuo et al', '14', 'in this study no significant change wasfound in vegf secretion after exposure ofhuvecstopramlintide', ' since theupregulation of vegf expression and also itsrelease have been reported by other members ofamylin superfamily evaluation of vegfmrna expression using reverse transcriptionpolymerase chain reaction rtpcr alongwith peptide measurements by more accuratemethods such as western blotting isrecommended', 'regardingourresultssignificantdifferences were observed between twoconcentrations of pramlintide on averagetubules length and size and the number ofjunctions and it could be proposed thatpramlintide may have a concentrationdiscussionpramlintide is a new glucoselowering agentwhich has been effective in reducingglycosylated hemoglobin and improvingglycemic control in diabetic patients incombination therapy with mealtime insulin', 'unlike amylin which has an extreme toxicamyloidogenicity effect and is unsuitable forclinical use pramlintide is a nonaggregatingpeptide that prevents amyloid formation 19', 'angiogenesis shows a critical role in thepathogenesis of some major complications ofdiabetes', 'in this study pramlintide as an amylinanalogue promoted angiogenesis markers byincreasing migration and tube formation inhuvecs however no significant changeswere observed in the vegf releaseed into thesupernatants of huvecs', 'amylin belongs to a superfamily of closelyrelated genes with similar biological activityprofile and crossreactivity between receptorswhich are distributed in many tissues such asbraingastrointestinalcardiovascularendothelial and smooth muscle tissues 20', 'the main receptors for these structurally relatedpeptides include calcitonin receptor calcitoninreceptorlike receptor crlr and receptoractivitymodifying proteins ramps that arecoexpressed in different proportions in varioustissues', ' it is proven that some of these receptorssuch as ramps have a critical role inangiogenesis during wound healing 21', 'however the role of amylin in angiogenesis isnot fully understood unlike other members', ' itis well known that adrenomedullin is amodulator of growth and movement protectorfrom apoptosis and a potent angiogenic growthfactor in endothelial cells via stimulation of aktand mitogenactivated protein kinase andupregulation of vegf expression throughcrlrramp2crlrramp3 receptors 12', 'calcitonin promotes proliferation migrationinvasion and tube formation in endothelialcells in a concentrationdependent manner andsimilarly to vegf 13', ' cgrp also increasesvegf expression and stimulates proliferationmigration and angiogenesis of endothelialcells through activation of adenosinemonophosphateactivatedproteinkinaseeffect of pramlintide on angiogenesisdependent effect on angiogenesis withproangiogenic effects at lower concentrations', 'some possible mechanisms for enhancingangiogenesis by pramlintide may be consideredbased on its potential pharmacologicalactivities and the cellular signaling pathways ofpramlintide and amylin', ' wu et al', ' have shownthe effect of pramlintide in reducing theexpression of some matrix metalloproteinasesincluding mmp3 mmp9 and mmp13enzymes and improving neuronal cell survival22', ' specific mmps such as mmp2 areinvolved in enhancing angiogenesis by degradingthe capillary basement membrane 24', 'finally it could be assumed that probableantioxidant effect of pramlintide may be anindirect mechanism for its possible proangiogenic effect', ' pramlintide has reducedoxidizedlowdensitylipoproteinandnitrotyrosine and prevented from the reductionin the total radicaltrapping antioxidantparameter in plasma samples of diabeticpatients 25', ' pramlintide has shown a helpfuleffect on antioxidant enzymes such assuperoxidedismutaseandglutathioneperoxidase and on the stress marker hemeoxygenase1', ' it also resulted in a significantdecrease in the production of reactive oxygenspecies and lipid peroxidation in a neuronalmodel of oxidative stress in vitro 26', 'although enhancement of angiogenesis maybe helpful in improving of such diabetescomplications such as wound healing andischemic conditions but may aggregate otherproblems like diabetic retinopathy', ' concerningthe tissuespecific manner of angiogenesis indiabetes more investigations should beperformed to elucidate the effect of pramlintideon angiogenesis in different tissues', 'acknowledgmentsthis study was financially supported by thevicechancellery of research and technologyof isfahan university of medical sciencesisfahan i', 'r', ' under grant no', ' 196157', 'conflict of interest statementthe authors declare no conflict of interest inthis study', 'authors contributionl', ' safaeian contributed to the conceptdesign definition of intellectual contentmanuscript preparation and editing', ' g', 'vaseghi m', ' mirian and m', ' dehghaniperformed the experimental studies dataacquisition and statistical analysis', '', 'in conclusion the findings of the presentstudy showed the stimulating effect ofpramlintide on some angiogenesis markersthroughpromotingmigrationandtubulogenesis', ' in vivo and clinical evaluationsare needed to determine the potentialtherapeutic value of pramlintide for improvingneovascularization in vascular complicationsand healing of diabetic wounds', '10', ' ratner re dickey r fineman m maggs dg shenl strobel sa et al', ' amylin replacement withpramlintide as an adjunct to insulin therapy improveslongterm glycaemic and weight control in type 1diabetes mellitus a 1year randomized controlledtrial', ' diabet med', ' 2004211112041212', 'doi 10', '1111j', '14645491', '2004', '01319', 'x', '11', ' hasbak p opgaard os eskesen k schifter sarendrup h longmore j et al', ' investigation ofcgrp receptors and peptide pharmacology in humancoronary arteries', ' characterization with nonpeptideantagonist', ' j pharmacol exp ther', ' 20033041326333', 'doi 10', '1152physrev', '00037', '2003', '12', ' ribatti d nico b spinazzi r vacca a nussdorfergg', ' the role of adrenomedullin in angiogenesis', 'peptides', ' 200526916701675', 'doi 10', '1016j', 'peptides', '2005', '02', '017', '13', ' chigurupati s kulkarni t thomas s shah g', 'calcitonin stimulates multiple stages of angiogenesisby directly acting on endothelial cells', ' cancer res', '2005651885198529', 'doi 10', '115800085472', 'can050848', '14', ' tuo y guo x zhang x wang z zhou j xia l etal', ' the biological effects and mechanisms ofcalcitonin generelated peptide on human endothelialcell', ' j recept signal transduct res', ' 2013332114123', 'doi 10', '310910799893', '2013', '770528', '15', ' akbari v sadeghi hm jafariandehkordi a abedid chou cp', ' improved biological activity of a singlechain antibody fragment against human epidermalgrowth factor receptor 2 her2 expressed in theperiplasm of escherichia coli', ' protein expr purif', '20151166674', 'doi 10', '1016j', 'pep', '2015', '07', '005', '16', ' justus cr leffler n ruizechevarria m yang lv', 'in vitro cell migration and invasion assays', ' j vis exp', '20148818', 'doi 10', '379151046', '17', ' dana n haghjooy javanmard sh rafiee l', 'antiangiogenic and antiproliferative effects of blackpomegranate peel extract on melanoma cell line', ' respharm sci', ' 2015102117124', '18', ' liegl r koenig s siedlecki j haritoglou c kampika kernt m', ' temsirolimus inhibits proliferation andmigration in retinal pigment epithelial and endothelialmigration in retinal pigment epithelial and endothelial', 'cells via mtor inhibition and decreases vegf andpdgf expression', ' plos one', ' 201492e88203110', 'doi 10', '1371journal', 'pone', '0088203', '19', ' bai y ma jx guo j wang j zhu m chen y et al', 'müller cellderived vegf is a significant contributortoretinalneovascularization', 'jpathol', '20092194446454', 'doi 10', '1002path', '2611', '20', ' brain sd grant ad', ' vascular actions of calcitoningenerelated peptide and adrenomedullin', ' physiolrev', ' 2004843903934', 'doi 10', '1152physrev', '00037', '200321', ' kurashige c hosono k matsuda h tsujikawa kokamoto h majima m', ' roles of receptor activitymodifying protein 1 in angiogenesis andlymphangiogenesis during skin wound healing inmice', ' faseb j', ' 201428312371247', 'doi 10', '1096fj', '13238998', '22', ' wu x song y li s liu x hua w wang k et al', 'pramlintide regulation of extracellular matrix ecmand apoptosis through mitochondrialdependentpathways in human nucleus pulposus cells', ' int jimmunopathol pharmacol', ' 2017311114', 'doi 10', '11770394632017747500', '23', ' caruso g fresta c lazzarino g distefano daparlascino p lunte sm et al', ' subtoxic humanamylin fragment concentrations promote the survivaland proliferation of shsy5y cells via the release ofvegf and hspb5 from endothelial rbe4 cells', ' int jmol sci', ' 20181911e3659118', 'doi 10', '3390ijms19113659', '24', ' rundhaug je', ' matrix metalloproteinases andangiogenesis', ' j cell mol med', ' 200592267285', 'doi 10', '1111j', '15824934', '2005', 'tb00355', 'x', '25', ' ceriello a piconi l quagliaro l wang y schnabelca ruggles ja et al', ' effects of pramlintide onpostprandial glucose excursions and measures ofoxidative stress in patients with type 1 diabetes', 'diabetes care', ' 2005283632637', 'doi 10', '2337diacare', '28', '3', '632', '26', ' patrick s corrigan r grizzanti j mey m blair jpallas m et al', ' neuroprotective effects of the amylinanalog pramlintide on alzheimers disease areassociated with oxidative stress regulationmechanisms', ' j alzheimers dis', ' 2019691157168', 'doi 10', '3233jad180421', '', '1', ' world health statistics world health organizationgeneva who press 2018', ' p', ' 7', '2', ' international diabetes federation idf atlas 7theditionaccessed2019', 'availablefromhttpwww', 'diabetesatlas', 'org', '3', ' chawla a chawla r jaggi s', ' microvasular andmacrovascular complications in diabetes mellitusdistinct or continuum indian j endocrinol metab', '2016204546551', 'doi 10', '410322308210', '183480', '4', ' cheng r ma jx', ' angiogenesis in diabetes andobesity', ' rev endocr metab disord', ' 20151616775', 'doi 10', '1007s1115401593107', '5', ' goodwin am', ' in vitro assays of angiogenesis forassessment of angiogenic and antiangiogenic agents', 'microvasc res', ' 20077423172183', 'doi 10', '1016j', 'mvr', '2007', '05', '006', '6', ' zuazogaztelu i casanovas o', ' unraveling the role ofangiogenesis in cancer ecosystems', ' front oncol', '20188248260', 'doi 10', '3389fonc', '2018', '00248', '7', ' martin a komada mr sane dc', ' abnormalangiogenesis in diabetes mellitus', ' med res rev', '2003232117145', 'doi 10', '1002med', '10024', '8', ' edelman s maier h wilhelm k', ' pramlintide in thetreatment of diabetes mellitus', ' biodrugs', '2008226375386', 'doi 10', '2165006303020082206000004', '9', ' hollander p maggs dg ruggles ja fineman mshen l kolterman og et al', ' effect of pramlintideon weight in overweight and obese insulintreatedtype 2 diabetes patients', ' obes res', ' 2004124661668', 'doi 10', '1038oby', '2004', '76', '', '']}\n"
     ]
    }
   ],
   "source": [
    "documents = corp.split_sentences()\n",
    "print(documents)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "  ⠀"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Model"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [],
   "source": [
    "from gensim.models import Word2Vec\n",
    "from gensim.models import KeyedVectors"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [],
   "source": [
    "model = KeyedVectors.load_word2vec_format('pubmed_model/pubmed2018_w2v_200D/pubmed2018_w2v_200D.bin', binary=True)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "  ⠀"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Preprocessing and Querying"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Library Imports"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [],
   "source": [
    "# numpy imports\n",
    "import numpy as np\n",
    "from numpy import dot\n",
    "from numpy.linalg import norm\n",
    "\n",
    "import re\n",
    "\n",
    "# nltk imports\n",
    "import nltk\n",
    "from nltk import punkt\n",
    "from nltk.corpus import stopwords \n",
    "from nltk.tokenize import word_tokenize\n",
    "\n",
    "# punctuation list\n",
    "puncs=\"!#$%&'()*+,-./:;<=>?@[\\]^_`{|}~\""
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Create Word2vec representation for all sentences in documents"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "C:\\Users\\vabha\\Anaconda3\\lib\\site-packages\\ipykernel_launcher.py:16: RuntimeWarning: invalid value encountered in true_divide\n",
      "  app.launch_new_instance()\n"
     ]
    }
   ],
   "source": [
    "doc2vec=dict()\n",
    "\n",
    "stop_words = set(stopwords.words('english')) \n",
    "\n",
    "for title, sentences in documents.items():\n",
    "    doc2vec[title]=[]\n",
    "    for sentence in sentences:\n",
    "        sentence=re.sub('[^A-Za-z]+', ' ', sentence)\n",
    "        sentence_centroid=np.zeros((200,))\n",
    "        for word in word_tokenize(sentence.lower()):\n",
    "            if word not in stop_words:\n",
    "                try:\n",
    "                    sentence_centroid+=model[word]\n",
    "                except:\n",
    "                    pass\n",
    "        sentence_centroid/=len(word_tokenize(sentence))\n",
    "        doc2vec[title].append(sentence_centroid.tolist())"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {},
   "outputs": [],
   "source": [
    "import json\n",
    "with open('data.txt', 'w') as json_file:\n",
    "  json.dump(doc2vec, json_file)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Create Engine"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Import Utilities"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {},
   "outputs": [],
   "source": [
    "from utility import SearchEngine, Evaluator\n",
    "from pprint import pprint"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 22,
   "metadata": {},
   "outputs": [],
   "source": [
    "class Engine(SearchEngine):\n",
    "    \n",
    "    def search(query):\n",
    "        \n",
    "        query_len=0\n",
    "        query_vec=np.zeros((200,))\n",
    "        result_list=dict()\n",
    "\n",
    "        #preprocess the query\n",
    "        query=re.sub('[^A-Za-z]+', ' ', query).lower()\n",
    "\n",
    "        for word in word_tokenize(query):\n",
    "            if word not in stop_words:\n",
    "                try:\n",
    "                    query_vec+=model[word]\n",
    "                    query_len+=1\n",
    "                except:\n",
    "                    pass\n",
    "                \n",
    "        query_vec/=query_len\n",
    "        \n",
    "        for key, vectors in doc2vec.items():\n",
    "            result_list[key]=0\n",
    "            for vector in vectors:\n",
    "                if np.isnan(vector).any():\n",
    "                    pass\n",
    "                else:\n",
    "                    cos_sim = np.dot(vector, query_vec)/(np.linalg.norm(vector)*np.linalg.norm(query_vec))\n",
    "                    if result_list[key]<cos_sim:\n",
    "                        result_list[key]=cos_sim\n",
    "            \n",
    "        return result_list"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 23,
   "metadata": {},
   "outputs": [
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "C:\\Users\\vabha\\Anaconda3\\lib\\site-packages\\ipykernel_launcher.py:28: RuntimeWarning: invalid value encountered in double_scalars\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "{'A Comprehensive Review Article On Isoprostanes As Biological Markers': 0.7387905746822652,\n",
      " 'Anti Toxoplasma Gondii Activity Of 5 Oxo Hexahydroquinoline Derivatives   Synthesis, In Vitro And In Vivo Evaluations, And Molecular Docking Analysis': 0.6220698997991283,\n",
      " 'Assembling Structurally Customizable Synthetic Carriers': 0.6462379131063613,\n",
      " 'Asymptomatic Carrier State  Acute Respiratory Disease': 0.47532684149702054,\n",
      " 'Covid-19 Pathogenesis, Cytokine Storm And Cytokine Growth Factor Reviews': 0.5349942003186308,\n",
      " 'Deamidation In Moxetumomab Pasudotox Leading To Conformational Change And Immunotoxin Activity Loss': 0.640894273851751,\n",
      " 'Development Of Muco Adhesive Orally Disintegrating Tablets Containing Tamarind Gum Coated Tea Powder': 0.6668651549039779,\n",
      " 'Hollow Fiber Based Liquid Phase Microextraction': 0.6316439155642612,\n",
      " 'Molecular Immune Pathogenesis And Diagnosis Of Covid 19': 0.6174888947568168,\n",
      " 'Molecular Pharmaceuticals': 0.5002605603677397,\n",
      " 'Multi Dimensional Visualization For The Morphology': 0.5836445294191335,\n",
      " 'Nanotechnology And Vaccine Development': 0.7594418290986463,\n",
      " 'Pegylation In Anti Cancer Therapy': 0.7603444227551914,\n",
      " 'Pharmaceutical Care In A Patient With Recurrent Infection After Liver Transplant': 0.4380021961445737,\n",
      " 'Pharmacological Options Beyond Proton Pump Inhibitors In Childrenwith Gastroesophageal Reflux Diseas': 0.526742265238081,\n",
      " 'Phospolipids And Application': 0.7898815488558147,\n",
      " 'Phytochemical Screening And Evaluation Of Analgesic And Thrombolytic Activity Of The Crude Methanoli': 0.592633531430782,\n",
      " 'Real Time Calorimetric Characterisation Of Clay Drug Complex Dispersions And Particles': 0.5752704097879632,\n",
      " 'Recent Advances And Perspectives Of Nucleic Acid': 0.5911342286578061,\n",
      " 'Redox Responsive Biocompatible Nanocarriers': 0.6463417598266002,\n",
      " 'Redox Sensitive  Peg Shielded Carboxymethyl Pei': 0.633593963396704,\n",
      " 'Regorafenib Loaded Poly  Lactide Co Glycolide  Microspheres': 0.5682659847761456,\n",
      " 'The Effect Of Pramlintide, An Antidiabetic Amylin Analogue On Angiogenesis Related Markers In Vitro': 0.5542237812964966}\n"
     ]
    }
   ],
   "source": [
    "query = 'the structures phospholipids'\n",
    "\n",
    "pprint(Engine.search(query))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Evaluation"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 24,
   "metadata": {},
   "outputs": [],
   "source": [
    "eva = Evaluator(corp, Engine)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 26,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Input n: 3\n"
     ]
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "C:\\Users\\vabha\\Anaconda3\\lib\\site-packages\\ipykernel_launcher.py:28: RuntimeWarning: invalid value encountered in double_scalars\n",
      "C:\\Users\\vabha\\Anaconda3\\lib\\site-packages\\ipykernel_launcher.py:20: RuntimeWarning: invalid value encountered in true_divide\n"
     ]
    },
    {
     "ename": "KeyboardInterrupt",
     "evalue": "",
     "output_type": "error",
     "traceback": [
      "\u001b[1;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[1;31mKeyboardInterrupt\u001b[0m                         Traceback (most recent call last)",
      "\u001b[1;32m<ipython-input-26-b421601655d9>\u001b[0m in \u001b[0;36m<module>\u001b[1;34m\u001b[0m\n\u001b[1;32m----> 1\u001b[1;33m \u001b[0mpprint\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0meva\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mevaluate\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0mmethod\u001b[0m\u001b[1;33m=\u001b[0m\u001b[1;34m'top-N-results'\u001b[0m\u001b[1;33m,\u001b[0m \u001b[0mkey\u001b[0m\u001b[1;33m=\u001b[0m\u001b[1;34m'all'\u001b[0m\u001b[1;33m,\u001b[0m \u001b[0mnum_queries\u001b[0m\u001b[1;33m=\u001b[0m\u001b[1;36m50\u001b[0m\u001b[1;33m,\u001b[0m \u001b[0mnum_docs\u001b[0m\u001b[1;33m=\u001b[0m\u001b[1;36m20\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[1;32m~\\Desktop\\College\\EDI\\utility.py\u001b[0m in \u001b[0;36mevaluate\u001b[1;34m(self, key, num_queries, num_docs, method)\u001b[0m\n\u001b[0;32m    180\u001b[0m                 \u001b[1;32mfor\u001b[0m \u001b[0mquery\u001b[0m \u001b[1;32min\u001b[0m \u001b[0mqueries\u001b[0m\u001b[1;33m[\u001b[0m\u001b[0mdocument\u001b[0m\u001b[1;33m]\u001b[0m\u001b[1;33m:\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0;32m    181\u001b[0m                     \u001b[0mi\u001b[0m \u001b[1;33m+=\u001b[0m \u001b[1;36m1\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[1;32m--> 182\u001b[1;33m                     \u001b[0mtitle_dict\u001b[0m \u001b[1;33m=\u001b[0m \u001b[0mself\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mengine\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0msearch\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0mquery\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0m\u001b[0;32m    183\u001b[0m                     \u001b[0mconsider\u001b[0m \u001b[1;33m=\u001b[0m \u001b[1;33m[\u001b[0m\u001b[0mi\u001b[0m\u001b[1;33m[\u001b[0m\u001b[1;36m0\u001b[0m\u001b[1;33m]\u001b[0m \u001b[1;32mfor\u001b[0m \u001b[0mi\u001b[0m \u001b[1;32min\u001b[0m \u001b[0msorted\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0mtitle_dict\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mitems\u001b[0m\u001b[1;33m(\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m,\u001b[0m \u001b[0mkey\u001b[0m\u001b[1;33m=\u001b[0m\u001b[0mitemgetter\u001b[0m\u001b[1;33m(\u001b[0m\u001b[1;36m1\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m,\u001b[0m \u001b[0mreverse\u001b[0m\u001b[1;33m=\u001b[0m\u001b[1;32mTrue\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m[\u001b[0m\u001b[1;36m0\u001b[0m\u001b[1;33m:\u001b[0m\u001b[0mn\u001b[0m\u001b[1;33m]\u001b[0m\u001b[1;33m]\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0;32m    184\u001b[0m                     \u001b[1;32mif\u001b[0m \u001b[0mdocument\u001b[0m \u001b[1;32min\u001b[0m \u001b[0mconsider\u001b[0m\u001b[1;33m:\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n",
      "\u001b[1;32m<ipython-input-22-5eb329918953>\u001b[0m in \u001b[0;36msearch\u001b[1;34m(query)\u001b[0m\n\u001b[0;32m     26\u001b[0m                     \u001b[1;32mpass\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0;32m     27\u001b[0m                 \u001b[1;32melse\u001b[0m\u001b[1;33m:\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[1;32m---> 28\u001b[1;33m                     \u001b[0mcos_sim\u001b[0m \u001b[1;33m=\u001b[0m \u001b[0mnp\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mdot\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0mvector\u001b[0m\u001b[1;33m,\u001b[0m \u001b[0mquery_vec\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m/\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0mnp\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mlinalg\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mnorm\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0mvector\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m*\u001b[0m\u001b[0mnp\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mlinalg\u001b[0m\u001b[1;33m.\u001b[0m\u001b[0mnorm\u001b[0m\u001b[1;33m(\u001b[0m\u001b[0mquery_vec\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m)\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0m\u001b[0;32m     29\u001b[0m                     \u001b[1;32mif\u001b[0m \u001b[0mresult_list\u001b[0m\u001b[1;33m[\u001b[0m\u001b[0mkey\u001b[0m\u001b[1;33m]\u001b[0m\u001b[1;33m<\u001b[0m\u001b[0mcos_sim\u001b[0m\u001b[1;33m:\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n\u001b[0;32m     30\u001b[0m                         \u001b[0mresult_list\u001b[0m\u001b[1;33m[\u001b[0m\u001b[0mkey\u001b[0m\u001b[1;33m]\u001b[0m\u001b[1;33m=\u001b[0m\u001b[0mcos_sim\u001b[0m\u001b[1;33m\u001b[0m\u001b[1;33m\u001b[0m\u001b[0m\n",
      "\u001b[1;32m<__array_function__ internals>\u001b[0m in \u001b[0;36mdot\u001b[1;34m(*args, **kwargs)\u001b[0m\n",
      "\u001b[1;31mKeyboardInterrupt\u001b[0m: "
     ]
    }
   ],
   "source": [
    "pprint(eva.evaluate(method='top-N-results', key='all', num_queries=50, num_docs=20))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Input n: 3\n"
     ]
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "C:\\Users\\vabha\\Anaconda3\\lib\\site-packages\\ipykernel_launcher.py:28: RuntimeWarning: invalid value encountered in double_scalars\n"
     ]
    }
   ],
   "source": [
    "pprint(eva.evaluate(method='top-N-results', key='abstract', num_queries=50, num_docs=20))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 23,
   "metadata": {},
   "outputs": [],
   "source": [
    "vector=(model[\"hydrocarbon\"]+model[\"radical\"]+model[\"c2h5\"]+model[\"ethane\"]+model[\"acetate\"]+model[\"alkyl\"]+model[\"methyl\"]+model[\"formate\"])/8\n",
    "query_vec=model[\"ethyl\"]\n",
    "cos_sim = np.dot(vector, query_vec)/(np.linalg.norm(vector)*np.linalg.norm(query_vec))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 24,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "0.7261528"
      ]
     },
     "execution_count": 24,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "cos_sim"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.7.4"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 4
}