Python: Find a motif

"""
Find a motif PLUS 2 flanking bp in a seq: User can search for a specific motif or search for a category of motifs 
(i.e. ALL of the consensus/1bp/2bp off motifs) Position and occurrence will be reported. You can change the consensus motif and seq 
to ANY length/nucleotides. Appliable to amino acids search. 
"""
consensus_motif= "CACGTG" # Very Portable! Can change the concensus motif here or by asking for user's input
# Find a motif. Position and occurrence reported
def find_motif(motif,seq):
    occurrence=0
    position=[]
    while motif in seq:
        index=seq.find(motif)
        seq= seq[:index] + seq[index+len(motif):] # REMOVE the first detected motif
        position.append(index + occurrence * len(motif)) # ADD the original start position
        print (seq[index-2:index] + " " + motif+ " " + seq[index+1:index+3] + ": " + str(index + occurrence * len(motif)))
        occurrence= occurrence + 1
    if len(position) != 0:
        print (motif+ " Position: " + str(position))
        print ("occurrence of the motif: " + str(occurrence))
    else: 
        print (motif + ": Not Found")
    
# Fuzzy search of all 1 base pair off motifs
my_list = ["C", "A", "T", "G"]
def find_1_bp_off_motif():
    all_1_bp_off_motifs=[] # Will include all posible variants
    for i in range(len(consensus_motif)): # len(consensus_motif)='6' is the length of the core motif. Each cycle will change the 'i'th position of the consensus motif
        for j in range(4): # '4' is length of 'my_list' or the four nucleotides. 'j' specifies the nucleotide. Each cycle will produce one variant at position 'i'
            variant= ""
            if my_list[j] == consensus_motif[i]:
                continue # Remove when the nucleotide is the same as that in consensus motif
            else:
                variant = consensus_motif[:i] + str(my_list[j]) + consensus_motif[i+1:]
                all_1_bp_off_motifs.append(variant) 
    print ("Number of motifs: " + str(len(all_1_bp_off_motifs)))
    for i in range(len(all_1_bp_off_motifs)):
        find_motif(all_1_bp_off_motifs[i], seq)       

# Fuzzy search of all 2 base pair off motifs
def find_2_bp_off_motif():
    all_2_bp_off_motifs=[] # Will include all possible variants
    for i in range(len(consensus_motif)-1): # CACGTG: len(consensus_motif)-1=5 combinations for 2 mutations:( 'i'=0: 'C' + one of 'ACGTG', 'i'=1: 'A' + one of 'CGTG', 'i'=2: 'C' + 'GTG','i'=3: G + 'TG' and 'i'=4: 'T' + 'G')
        for j in range(4): # Each cycle will produce all variants with two mutations at position 'i' and the other position 
            one_mutation_variant= ""
            if my_list[j] == consensus_motif[i]:
                continue
            else:
                one_mutation_variant = consensus_motif[:i] + str(my_list[j]) + consensus_motif[i+1:] # Make a first mutation at the 'i'th position 
            for k in range(i+1, len(consensus_motif), 1): # Second mutation at position k (not i but after i)
                for m in range(4): # '4' is length of 'my_list' or the four nucleotides.. Specify substitution by m
                    variant= one_mutation_variant
                    if my_list[m] == one_mutation_variant[k]:
                        continue # Remove when the nucleotide is the same as that of consensus motif
                    else:
                        variant = one_mutation_variant[:k] + str(my_list[m]) + one_mutation_variant[k+1:] # Make the second mutation and get the final variant
                    all_2_bp_off_motifs.append(variant) 
    print ("Number of motifs: " + str(len(all_2_bp_off_motifs)))
    for i in range(len(all_2_bp_off_motifs)):
        find_motif(all_2_bp_off_motifs[i], seq)
    
# Sequence PMU2 in C. glabrata
seq = "TGCAACTGTCAACGTAAAAGTCATCGAGTACTTGAGGGAAACTTTAGGTGTGCACACGTGTGATGAACGTGTAAGCCACTCCCAGGCTTTGTCAGAATACCAGGACCACAGGTATAACAACAGTGATGTCACTGTCCATTTCGACTACCCTGGTAATTACTCGGAGAAGGATCAGCTATGGTATCCCGACCATAGAGAGACTAAAGCAGAAATGGATAGAAGAACAAGAATAGGGTTGCGTGAGATGTTCTCAAGTGTCAATACTACGGACAAGGTGATATCATTGACATGCCATTCCGGTGTTATCGCCAGTGTGCTGAGAAACATAAAACACCCAGCTATAGACCACTTGCAAACGGGGAAACTTGTATATGCTGTGGTAGAGCTATCTAAGGCGCCTACAGATGATCAACCAATGCTTGTTGTGTCATAAAGAATGCCCGGAATTCTACTGATCGAATTGACATGATCGCTTATTTTTATAATCGCTCTCTATGTTTTGATACCTTATGTCGCTAATATTTGACTCTGTATGCCGTTGTATTTGCTTATACATATTATACTATTTTCAATTATTGTTTTTTTTTATCATTTAGTTCATTTATCAACGAATAACCAGGTGTACATTTTTTATTTGCTCTGGTTATCTTTAACATCATACTAAGATCAAAAAAGGGGAAAACAAAAACTAATATCTAAGAGAAACACTAAGCATCTAAGCTCAGTATCTTTACTTTTTAATTAAATATCTCATTTCTCCGCCCCGTGTATGCCTCCTCCATGTATTTTAAATAATCAAATTAAATTAATTGTAAATTAACTTTTTAACATTTTGTTCTTTACCCTGTACCCAATCGATTGCAACTGTTATCCTATCACAAATTTTTTTGTTGAATTCTATGCACTCTTTTTGAATATGTCGATGCATGCTCCTAGCCTCAATTTGTTACTCTCACGTATAGCTGAGATTGTCAAAAGGTTCTTATTTGACTGCTCGTGGGATAACTTGATTTTTCTTGCTCGATAAGCAAATACTCAATTACTTTCTTGACATGCATAAACAATAATGTATGGCCTAATGGAATGAGCCATTTACATGGAATTTTAACAGTACAGCTATATGTAAGATAATCACTGTTGTAAGAATAAATGTAAATATTTAGTGATTGTAAGCGGTTCGTGCGATAGAAATTCTGCGTTATCATTGGTTGGTGTGAAATTGCACCACATATATTGCAGAACATTACTTATCTATGGATTGAAACACCCATGTGCTCTTTTTAATTACTAGAAATTATTATATCAATGCAATCGAGATACACTTCTAGATAACACGATTATTTTGCGATAGGAATAATAGCCAAAAATCCCTCTTCAAACATATAAAAAGGCACAATTATCATATATCATCCTTAGCATTGTTCTCAGATTAAATGATAACTTAGATATCAAATTATAACTATCATCCCATATATCAAATAAATATCCACTCTCGTTACA"
# Report the length of the seq
print ("The length of the seq: " + str(len(seq)))

# Ask if the user wants to search for a specific motif or search for all of the consensus/1 bp/2 bp off motif
x= True
while x:  # Force the user to enter 0/1. Will rerun if the user enters other intergers
    choice= int(input("Enter 0 if searching for a specific motif. Enter 1 if searching for a category: ALL of the consensus/1bp/2bp off motifs(Must be 0 or 1!): "))

    if choice== 0: # Searching a specific motif for any times
        s= True
        while s:
            motif= input("Enter your motif(Enter quit to exit): ")
            # Ensure uppercase
            motif= motif.upper()
            if motif == "QUIT":
                s= False
            else:

                # Output: position and occurrences
                find_motif(motif, seq)
        x= False
    elif choice == 1: # Searching a category
        # Ask for consensus motif or 1-bp off motif. While loop ensure entering 0/1
        s= True
        while s:
            num_bp_off= int(input("How many base pair off from the consensus motif(Enter 0/1/2): "))
            if num_bp_off==0:
                find_motif(consensus_motif,seq)
                s= False
            elif num_bp_off==1:
                find_1_bp_off_motif()
                s= False
            elif num_bp_off==2:
                find_2_bp_off_motif()
                s= False
            else:
                print ("Invalid Input! Must be 0 or 1!")
        x= False
    else: # When the users enters an interger except 0 or 1
        print ("Must be 0 or 1!")